diff --git a/examples/README.md b/examples/README.md index eb11d8f..90468c3 100644 --- a/examples/README.md +++ b/examples/README.md @@ -15,6 +15,23 @@ +# DRAGEN - 1 sample (simulated) over 2 reference collections +
Rulegraph + +![rulegraph.svg](dragen/rulegraph.svg) +
+ +
DAG + +![dag.svg](dragen/dag.svg) +
+ +
Filegraph + +![filegraph.svg](dragen/filegraph.svg) +
+ + # Empty - 1 negative control
Rulegraph diff --git a/examples/dragen/config/config.yaml b/examples/dragen/config/config.yaml new file mode 100644 index 0000000..9056e22 --- /dev/null +++ b/examples/dragen/config/config.yaml @@ -0,0 +1,149 @@ + +# - Only tested with Phred33 quality scores + +samples: config/samples.tsv + +units: config/units.tsv + + + +############# +### READS ### +############# +trim: + trim: + activate: true + tool: adapterremoval + params: "--trimns --maxns 10 --trimqualities --minlength 30 --mask-degenerate-bases --seed 12345" + + # Ignored for SE + collapse: + activate: true + params: "--collapse-conservatively" + +derep: + extension: + activate: false + k: 16 + params: "ibb=t prefilter=0 el=100 er=100 ecc=f ecco=f ignorebadquality extendrollback=0" + + derep: + activate: true + # vsearch or seqkit + tool: seqkit + params: "" + + low_complex: + params: "entropy=0.7 entropywindow=30 entropyk=4" + + + +############# +### ALIGN ### +############# +prefilter: + taxa: "Bacteria,Archaea,Viruses" + + ref: + hires_organelles_viruses_smags: + n_shards: 2 + path: "/staging/hash_tables/hires_organelles_viruses_smags.{n_shard}" + map: + tool: dragen + params: "--Mapper.edit-mode=1" + acc2taxid: "data/prok.acc2taxid.gz" + human_genome: + n_shards: 1 + path: "/staging/hash_tables/GCF_000001405.40_GRCh38.p14_genomic" + map: + tool: dragen + params: "--Mapper.edit-mode=0" + acc2taxid: "data/human.acc2taxid.gz" + + filter: + saturated_reads: + activate: true + n_alns: 500 + + bam_filter: + reassign: + activate: false + params: "--iters 0 --min-read-ani 92 --min-read-count 3 --scale 0 --reference-lengths genomes.len.map" + + filter: + activate: false + params: "--min-read-ani 92 --min-read-count 3 --min-normalized-entropy 0.6 --min-normalized-gini 0.4 --min-avg-read-ani 94 --reference-lengths genomes.len.map" + + lca: + activate: false + params: "--lca-rank genus --reference-lengths genomes.len.map" + + taxonomy: + nodes: "/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/nodes.dmp" + names: "/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/names.dmp" + + metadmg: + damage: + params: "--print_length 15" + + lca: + params: "--fix_ncbi 0 --how_many 25 --weight_type 1 --edit_dist_max 10000 --lca_rank genus" + + dfit: + params: "--nopt 5 --showfits 2" + + +euk: + ref: + refseq_mitoch: + n_shards: 1 + path: "/staging/hash_tables/refseq_mitochondrion.genomic/" + map: &map_euk_dragen + tool: dragen + params: "--Mapper.edit-mode=0" + acc2taxid: "data/mitoch.acc2taxid.gz" + core_nt: + n_shards: 4 + path: "/staging/hash_tables/core_nt.{n_shard}" + map: + <<: *map_euk_dragen + acc2taxid: "data/core_nt.acc2taxid.gz" + + filter: + saturated_reads: + activate: true + n_alns: 500 + + bam_filter: + reassign: + activate: false + params: "--iters 0 --min-read-ani 92 --min-read-count 3 --scale 0" + + filter: + activate: false + params: "--min-read-ani 92 --min-read-count 3 --min-normalized-entropy 0.6 --min-normalized-gini 0.4 --min-avg-read-ani 92" + + lca: + activate: false + params: "--lca-rank genus" + + taxonomy: + nodes: "data/taxdump/nodes.dmp" + names: "data/taxdump/names.dmp" + + metadmg: + damage: + params: "--print_length 15" + + lca: + params: "--fix_ncbi 0 --how_many 15 --sim_score_low 0.95 --weight_type 0 --edit_dist_max 10000 --lca_rank genus" + + dfit: + params: "--nopt 5 --showfits 2 --seed 12345" + + +############ +## REPORT ## +############ +report: + multiqc: "--no-ai --verbose --cl-config 'custom_logo: data/KU_long.png' --cl-config 'custom_logo_title: CAEG - Center for Ancient Environmental Genomics' --cl-config 'custom_logo_url: https://globe.ku.dk/research/caeg/'" diff --git a/examples/dragen/config/samples.tsv b/examples/dragen/config/samples.tsv new file mode 100644 index 0000000..5994081 --- /dev/null +++ b/examples/dragen/config/samples.tsv @@ -0,0 +1,2 @@ +sample alias group condition +Lib ancient diff --git a/examples/dragen/config/units.tsv b/examples/dragen/config/units.tsv new file mode 100644 index 0000000..4a8a376 --- /dev/null +++ b/examples/dragen/config/units.tsv @@ -0,0 +1,4 @@ +sample library flowcell lane seq_type library_type material data machine run_n sample_n date center platform adapters +Lib LVsim1 BHXXXXXXXX L001 PE ds DNA data/test_L001_R{Read}.fq.gz SIMULATED 0000 S1 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT +Lib LVsim1 BHXXXXXXXX L002 PE ds DNA data/test_L002_R{Read}.fq.gz SIMULATED 0000 S2 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT +Lib LVsim2 BHXXXXXXXX L001 PE ds DNA data/test_L003_R{Read}.fq.gz SIMULATED 0000 S3 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT diff --git a/examples/dragen/dag.svg b/examples/dragen/dag.svg new file mode 100644 index 0000000..c868f81 --- /dev/null +++ b/examples/dragen/dag.svg @@ -0,0 +1,3158 @@ + + + + + + +snakemake_dag + + + +0 + +target_taxon + + + +1 + +multiqc_taxon + + + +1->0 + + + + + +2 + +trim_fastqc_raw + + + +2->1 + + + + + +3 + +trim_get_fastq_raw +lane: L002 +library: LVsim1 +read_type_raw: R2 +sample: Lib + + + +3->2 + + + + + +15 + +trim_adapterremoval_fastq_pe + + + +3->15 + + + + + +4 + +trim_fastqc_raw + + + +4->1 + + + + + +5 + +trim_get_fastq_raw +lane: L001 +library: LVsim2 +read_type_raw: R2 +sample: Lib + + + +5->4 + + + + + +14 + +trim_adapterremoval_fastq_pe + + + +5->14 + + + + + +6 + +trim_fastqc_raw + + + +6->1 + + + + + +7 + +trim_get_fastq_raw +lane: L001 +library: LVsim1 +read_type_raw: R1 +sample: Lib + + + +7->6 + + + + + +16 + +trim_adapterremoval_fastq_pe + + + +7->16 + + + + + +8 + +trim_fastqc_raw + + + +8->1 + + + + + +9 + +trim_get_fastq_raw +lane: L001 +library: LVsim1 +read_type_raw: R2 +sample: Lib + + + +9->8 + + + + + +9->16 + + + + + +10 + +trim_fastqc_raw + + + +10->1 + + + + + +11 + +trim_get_fastq_raw +lane: L002 +library: LVsim1 +read_type_raw: R1 +sample: Lib + + + +11->10 + + + + + +11->15 + + + + + +12 + +trim_fastqc_raw + + + +12->1 + + + + + +13 + +trim_get_fastq_raw +lane: L001 +library: LVsim2 +read_type_raw: R1 +sample: Lib + + + +13->12 + + + + + +13->14 + + + + + +14->1 + + + + + +17 + +trim_fastqc_trim +read_type_trim: R1 + + + +14->17 + + + + + +19 + +trim_fastqc_trim +read_type_trim: collapsed + + + +14->19 + + + + + +22 + +trim_fastqc_trim +read_type_trim: R2 + + + +14->22 + + + + + +23 + +trim_fastqc_trim +read_type_trim: singleton + + + +14->23 + + + + + +30 + +trim_fastqc_trim +read_type_trim: collapsedtrunc + + + +14->30 + + + + + +35 + +derep_merge_lanes +read_type_trim: collapsed + + + +14->35 + + + + + +15->1 + + + + + +20 + +trim_fastqc_trim +read_type_trim: singleton + + + +15->20 + + + + + +21 + +trim_fastqc_trim +read_type_trim: collapsedtrunc + + + +15->21 + + + + + +25 + +trim_fastqc_trim +read_type_trim: R2 + + + +15->25 + + + + + +27 + +trim_fastqc_trim +read_type_trim: collapsed + + + +15->27 + + + + + +29 + +trim_fastqc_trim +read_type_trim: R1 + + + +15->29 + + + + + +33 + +derep_merge_lanes +read_type_trim: collapsed + + + +15->33 + + + + + +16->1 + + + + + +18 + +trim_fastqc_trim +read_type_trim: singleton + + + +16->18 + + + + + +24 + +trim_fastqc_trim +read_type_trim: R2 + + + +16->24 + + + + + +26 + +trim_fastqc_trim +read_type_trim: collapsed + + + +16->26 + + + + + +28 + +trim_fastqc_trim +read_type_trim: collapsedtrunc + + + +16->28 + + + + + +31 + +trim_fastqc_trim +read_type_trim: R1 + + + +16->31 + + + + + +16->33 + + + + + +17->1 + + + + + +18->1 + + + + + +19->1 + + + + + +20->1 + + + + + +21->1 + + + + + +22->1 + + + + + +23->1 + + + + + +24->1 + + + + + +25->1 + + + + + +26->1 + + + + + +27->1 + + + + + +28->1 + + + + + +29->1 + + + + + +30->1 + + + + + +31->1 + + + + + +32 + +derep_fastqc +tool: merge_lanes + + + +32->1 + + + + + +33->32 + + + + + +39 + +derep_nonpareil_infer +tool: merge_lanes + + + +33->39 + + + + + +43 + +derep_seqkit + + + +33->43 + + + + + +34 + +derep_fastqc +tool: merge_lanes + + + +34->1 + + + + + +35->34 + + + + + +37 + +derep_nonpareil_infer +tool: merge_lanes + + + +35->37 + + + + + +41 + +derep_seqkit + + + +35->41 + + + + + +36 + +derep_nonpareil_plot + + + +36->1 + + + + + +37->36 + + + + + +38 + +derep_nonpareil_plot + + + +38->1 + + + + + +39->38 + + + + + +40 + +derep_fastqc +tool: derep + + + +40->1 + + + + + +41->40 + + + + + +45 + +derep_low_complexity + + + +41->45 + + + + + +42 + +derep_fastqc +tool: derep + + + +42->1 + + + + + +43->42 + + + + + +47 + +derep_low_complexity + + + +43->47 + + + + + +44 + +derep_fastqc +tool: low_complexity + + + +44->1 + + + + + +45->44 + + + + + +73 + +prefilter_reads_extract + + + +45->73 + + + + + +80 + +taxon_prefilter_shard_dragen + + + +45->80 + + + + + +81 + +taxon_prefilter_shard_dragen_csv +n_shard: 1 +read_type_map: collapsed +ref: hires_organelles_viruses_smags +tot_shards: 2 + + + +45->81 + + + + + +84 + +taxon_prefilter_shard_dragen + + + +45->84 + + + + + +85 + +taxon_prefilter_shard_dragen_csv +n_shard: 1 +read_type_map: collapsed +ref: human_genome +tot_shards: 1 + + + +45->85 + + + + + +87 + +taxon_prefilter_shard_dragen + + + +45->87 + + + + + +88 + +taxon_prefilter_shard_dragen_csv +n_shard: 2 +read_type_map: collapsed +ref: hires_organelles_viruses_smags +tot_shards: 2 + + + +45->88 + + + + + +104 + +taxon_shard_dragen + + + +45->104 + + + + + +106 + +taxon_shard_dragen + + + +45->106 + + + + + +108 + +taxon_shard_dragen + + + +45->108 + + + + + +116 + +taxon_shard_dragen + + + +45->116 + + + + + +120 + +taxon_shard_dragen + + + +45->120 + + + + + +177 + +taxon_prefilter_shard_saturated_reads_extract + + + +45->177 + + + + + +181 + +taxon_shard_saturated_reads_extract + + + +45->181 + + + + + +46 + +derep_fastqc +tool: low_complexity + + + +46->1 + + + + + +47->46 + + + + + +49 + +prefilter_reads_extract + + + +47->49 + + + + + +56 + +taxon_prefilter_shard_dragen + + + +47->56 + + + + + +57 + +taxon_prefilter_shard_dragen_csv +n_shard: 1 +read_type_map: collapsed +ref: hires_organelles_viruses_smags +tot_shards: 2 + + + +47->57 + + + + + +60 + +taxon_prefilter_shard_dragen + + + +47->60 + + + + + +61 + +taxon_prefilter_shard_dragen_csv +n_shard: 1 +read_type_map: collapsed +ref: human_genome +tot_shards: 1 + + + +47->61 + + + + + +63 + +taxon_prefilter_shard_dragen + + + +47->63 + + + + + +64 + +taxon_prefilter_shard_dragen_csv +n_shard: 2 +read_type_map: collapsed +ref: hires_organelles_viruses_smags +tot_shards: 2 + + + +47->64 + + + + + +110 + +taxon_shard_dragen + + + +47->110 + + + + + +112 + +taxon_shard_dragen + + + +47->112 + + + + + +114 + +taxon_shard_dragen + + + +47->114 + + + + + +118 + +taxon_shard_dragen + + + +47->118 + + + + + +122 + +taxon_shard_dragen + + + +47->122 + + + + + +176 + +taxon_prefilter_shard_saturated_reads_extract + + + +47->176 + + + + + +180 + +taxon_shard_saturated_reads_extract + + + +47->180 + + + + + +48 + +prefilter_fastqc + + + +48->1 + + + + + +49->48 + + + + + +111 + +taxon_shard_dragen_csv +n_shard: 2 +ref: core_nt +tot_shards: 4 + + + +49->111 + + + + + +113 + +taxon_shard_dragen_csv +n_shard: 1 +ref: core_nt +tot_shards: 4 + + + +49->113 + + + + + +115 + +taxon_shard_dragen_csv +n_shard: 4 +ref: core_nt +tot_shards: 4 + + + +49->115 + + + + + +119 + +taxon_shard_dragen_csv +n_shard: 1 +ref: refseq_mitoch +tot_shards: 1 + + + +49->119 + + + + + +123 + +taxon_shard_dragen_csv +n_shard: 3 +ref: core_nt +tot_shards: 4 + + + +49->123 + + + + + +50 + +prefilter_reads_merge + + + +50->49 + + + + + +51 + +prefilter_reads_taxonomy + + + +51->50 + + + + + +52 + +taxon_prefilter_align_merge + + + +52->51 + + + + + +96 + +taxon_prefilter_align_stats + + + +52->96 + + + + + +99 + +taxon_prefilter_metadmg_lca + + + +52->99 + + + + + +178 + +taxon_prefilter_metadmg_damage + + + +52->178 + + + + + +53 + +taxon_prefilter_shard_sort_query + + + +53->52 + + + + + +54 + +taxon_prefilter_shard_unicorn + + + +54->53 + + + + + +55 + +taxon_prefilter_shard_saturated_reads_remove + + + +55->54 + + + + + +56->1 + + + + + +56->55 + + + + + +65 + +taxon_prefilter_shard_count_alns + + + +56->65 + + + + + +57->56 + + + + + +58 + +taxon_prefilter_shard_saturated_reads_filter + + + +58->50 + + + + + +58->55 + + + + + +68 + +taxon_prefilter_shard_saturated_reads_remove + + + +58->68 + + + + + +71 + +taxon_prefilter_shard_saturated_reads_remove + + + +58->71 + + + + + +58->176 + + + + + +59 + +taxon_prefilter_shard_count_alns + + + +59->58 + + + + + +60->1 + + + + + +60->59 + + + + + +60->68 + + + + + +61->60 + + + + + +62 + +taxon_prefilter_shard_count_alns + + + +62->58 + + + + + +63->1 + + + + + +63->62 + + + + + +63->71 + + + + + +64->63 + + + + + +65->58 + + + + + +66 + +taxon_prefilter_shard_sort_query + + + +66->52 + + + + + +67 + +taxon_prefilter_shard_unicorn + + + +67->66 + + + + + +68->67 + + + + + +69 + +taxon_prefilter_shard_sort_query + + + +69->52 + + + + + +70 + +taxon_prefilter_shard_unicorn + + + +70->69 + + + + + +71->70 + + + + + +72 + +prefilter_fastqc + + + +72->1 + + + + + +73->72 + + + + + +105 + +taxon_shard_dragen_csv +n_shard: 4 +ref: core_nt +tot_shards: 4 + + + +73->105 + + + + + +107 + +taxon_shard_dragen_csv +n_shard: 3 +ref: core_nt +tot_shards: 4 + + + +73->107 + + + + + +109 + +taxon_shard_dragen_csv +n_shard: 2 +ref: core_nt +tot_shards: 4 + + + +73->109 + + + + + +117 + +taxon_shard_dragen_csv +n_shard: 1 +ref: core_nt +tot_shards: 4 + + + +73->117 + + + + + +121 + +taxon_shard_dragen_csv +n_shard: 1 +ref: refseq_mitoch +tot_shards: 1 + + + +73->121 + + + + + +74 + +prefilter_reads_merge + + + +74->73 + + + + + +75 + +prefilter_reads_taxonomy + + + +75->74 + + + + + +76 + +taxon_prefilter_align_merge + + + +76->75 + + + + + +97 + +taxon_prefilter_align_stats + + + +76->97 + + + + + +101 + +taxon_prefilter_metadmg_lca + + + +76->101 + + + + + +179 + +taxon_prefilter_metadmg_damage + + + +76->179 + + + + + +77 + +taxon_prefilter_shard_sort_query + + + +77->76 + + + + + +78 + +taxon_prefilter_shard_unicorn + + + +78->77 + + + + + +79 + +taxon_prefilter_shard_saturated_reads_remove + + + +79->78 + + + + + +80->1 + + + + + +80->79 + + + + + +89 + +taxon_prefilter_shard_count_alns + + + +80->89 + + + + + +81->80 + + + + + +82 + +taxon_prefilter_shard_saturated_reads_filter + + + +82->74 + + + + + +82->79 + + + + + +92 + +taxon_prefilter_shard_saturated_reads_remove + + + +82->92 + + + + + +95 + +taxon_prefilter_shard_saturated_reads_remove + + + +82->95 + + + + + +82->177 + + + + + +83 + +taxon_prefilter_shard_count_alns + + + +83->82 + + + + + +84->1 + + + + + +84->83 + + + + + +84->92 + + + + + +85->84 + + + + + +86 + +taxon_prefilter_shard_count_alns + + + +86->82 + + + + + +87->1 + + + + + +87->86 + + + + + +87->95 + + + + + +88->87 + + + + + +89->82 + + + + + +90 + +taxon_prefilter_shard_sort_query + + + +90->76 + + + + + +91 + +taxon_prefilter_shard_unicorn + + + +91->90 + + + + + +92->91 + + + + + +93 + +taxon_prefilter_shard_sort_query + + + +93->76 + + + + + +94 + +taxon_prefilter_shard_unicorn + + + +94->93 + + + + + +95->94 + + + + + +96->1 + + + + + +97->1 + + + + + +98 + +taxon_prefilter_metadmg_dfit + + + +98->1 + + + + + +102 + +taxon_prefilter_metadmg_aggregate + + + +98->102 + + + + + +99->98 + + + + + +99->102 + + + + + +100 + +taxon_prefilter_metadmg_dfit + + + +100->1 + + + + + +103 + +taxon_prefilter_metadmg_aggregate + + + +100->103 + + + + + +101->100 + + + + + +101->103 + + + + + +102->0 + + + + + +102->1 + + + + + +103->0 + + + + + +103->1 + + + + + +104->1 + + + + + +153 + +taxon_shard_count_alns + + + +104->153 + + + + + +169 + +taxon_shard_saturated_reads_remove + + + +104->169 + + + + + +105->104 + + + + + +106->1 + + + + + +155 + +taxon_shard_count_alns + + + +106->155 + + + + + +166 + +taxon_shard_saturated_reads_remove + + + +106->166 + + + + + +107->106 + + + + + +108->1 + + + + + +157 + +taxon_shard_count_alns + + + +108->157 + + + + + +160 + +taxon_shard_saturated_reads_remove + + + +108->160 + + + + + +109->108 + + + + + +110->1 + + + + + +134 + +taxon_shard_count_alns + + + +110->134 + + + + + +137 + +taxon_shard_saturated_reads_remove + + + +110->137 + + + + + +111->110 + + + + + +112->1 + + + + + +131 + +taxon_shard_count_alns + + + +112->131 + + + + + +140 + +taxon_shard_saturated_reads_remove + + + +112->140 + + + + + +113->112 + + + + + +114->1 + + + + + +130 + +taxon_shard_count_alns + + + +114->130 + + + + + +146 + +taxon_shard_saturated_reads_remove + + + +114->146 + + + + + +115->114 + + + + + +116->1 + + + + + +154 + +taxon_shard_count_alns + + + +116->154 + + + + + +163 + +taxon_shard_saturated_reads_remove + + + +116->163 + + + + + +117->116 + + + + + +118->1 + + + + + +128 + +taxon_shard_saturated_reads_remove + + + +118->128 + + + + + +133 + +taxon_shard_count_alns + + + +118->133 + + + + + +119->118 + + + + + +120->1 + + + + + +151 + +taxon_shard_saturated_reads_remove + + + +120->151 + + + + + +156 + +taxon_shard_count_alns + + + +120->156 + + + + + +121->120 + + + + + +122->1 + + + + + +132 + +taxon_shard_count_alns + + + +122->132 + + + + + +143 + +taxon_shard_saturated_reads_remove + + + +122->143 + + + + + +123->122 + + + + + +124 + +taxon_align_stats + + + +124->1 + + + + + +125 + +taxon_align_merge + + + +125->124 + + + + + +171 + +taxon_metadmg_lca + + + +125->171 + + + + + +182 + +taxon_metadmg_damage + + + +125->182 + + + + + +126 + +taxon_shard_sort_query + + + +126->125 + + + + + +127 + +taxon_shard_unicorn + + + +127->126 + + + + + +128->127 + + + + + +129 + +taxon_shard_saturated_reads_filter + + + +129->128 + + + + + +129->137 + + + + + +129->140 + + + + + +129->143 + + + + + +129->146 + + + + + +129->180 + + + + + +130->129 + + + + + +131->129 + + + + + +132->129 + + + + + +133->129 + + + + + +134->129 + + + + + +135 + +taxon_shard_sort_query + + + +135->125 + + + + + +136 + +taxon_shard_unicorn + + + +136->135 + + + + + +137->136 + + + + + +138 + +taxon_shard_sort_query + + + +138->125 + + + + + +139 + +taxon_shard_unicorn + + + +139->138 + + + + + +140->139 + + + + + +141 + +taxon_shard_sort_query + + + +141->125 + + + + + +142 + +taxon_shard_unicorn + + + +142->141 + + + + + +143->142 + + + + + +144 + +taxon_shard_sort_query + + + +144->125 + + + + + +145 + +taxon_shard_unicorn + + + +145->144 + + + + + +146->145 + + + + + +147 + +taxon_align_stats + + + +147->1 + + + + + +148 + +taxon_align_merge + + + +148->147 + + + + + +173 + +taxon_metadmg_lca + + + +148->173 + + + + + +183 + +taxon_metadmg_damage + + + +148->183 + + + + + +149 + +taxon_shard_sort_query + + + +149->148 + + + + + +150 + +taxon_shard_unicorn + + + +150->149 + + + + + +151->150 + + + + + +152 + +taxon_shard_saturated_reads_filter + + + +152->151 + + + + + +152->160 + + + + + +152->163 + + + + + +152->166 + + + + + +152->169 + + + + + +152->181 + + + + + +153->152 + + + + + +154->152 + + + + + +155->152 + + + + + +156->152 + + + + + +157->152 + + + + + +158 + +taxon_shard_sort_query + + + +158->148 + + + + + +159 + +taxon_shard_unicorn + + + +159->158 + + + + + +160->159 + + + + + +161 + +taxon_shard_sort_query + + + +161->148 + + + + + +162 + +taxon_shard_unicorn + + + +162->161 + + + + + +163->162 + + + + + +164 + +taxon_shard_sort_query + + + +164->148 + + + + + +165 + +taxon_shard_unicorn + + + +165->164 + + + + + +166->165 + + + + + +167 + +taxon_shard_sort_query + + + +167->148 + + + + + +168 + +taxon_shard_unicorn + + + +168->167 + + + + + +169->168 + + + + + +170 + +taxon_metadmg_dfit + + + +170->1 + + + + + +174 + +taxon_metadmg_aggregate + + + +170->174 + + + + + +171->170 + + + + + +171->174 + + + + + +172 + +taxon_metadmg_dfit + + + +172->1 + + + + + +175 + +taxon_metadmg_aggregate + + + +172->175 + + + + + +173->172 + + + + + +173->175 + + + + + +174->0 + + + + + +174->1 + + + + + +175->0 + + + + + +175->1 + + + + + +176->0 + + + + + +177->0 + + + + + +178->0 + + + + + +179->0 + + + + + +180->0 + + + + + +181->0 + + + + + +182->0 + + + + + +183->0 + + + + + diff --git a/examples/dragen/data/KU_long.png b/examples/dragen/data/KU_long.png new file mode 100644 index 0000000..1a64e0e Binary files /dev/null and b/examples/dragen/data/KU_long.png differ diff --git a/examples/dragen/data/core_nt.acc2taxid.gz b/examples/dragen/data/core_nt.acc2taxid.gz new file mode 100644 index 0000000..85ed6ea Binary files /dev/null and b/examples/dragen/data/core_nt.acc2taxid.gz differ diff --git a/examples/dragen/data/human.acc2taxid.gz b/examples/dragen/data/human.acc2taxid.gz new file mode 100644 index 0000000..5e59800 Binary files /dev/null and b/examples/dragen/data/human.acc2taxid.gz differ diff --git a/examples/dragen/data/mitoch.acc2taxid.gz b/examples/dragen/data/mitoch.acc2taxid.gz new file mode 100644 index 0000000..a457cd4 Binary files /dev/null and b/examples/dragen/data/mitoch.acc2taxid.gz differ diff --git a/examples/dragen/data/prok.acc2taxid.gz b/examples/dragen/data/prok.acc2taxid.gz new file mode 100644 index 0000000..5dbe5f2 Binary files /dev/null and b/examples/dragen/data/prok.acc2taxid.gz differ diff --git a/examples/dragen/data/taxdump/names.dmp b/examples/dragen/data/taxdump/names.dmp new file mode 100644 index 0000000..a2db560 --- /dev/null +++ b/examples/dragen/data/taxdump/names.dmp @@ -0,0 +1,6450 @@ +1 | all | | synonym +1 | root | | scientific name +2 | "Bacteria" Cavalier-Smith 1987 | | authority +2 | "Bacteriobiota" Luketa 2012 | | authority +2 | Bacteria | Bacteria | scientific name +2 | Bacteria (ex Cavalier-Smith 1987) | | synonym +2 | Bacteria Woese et al. 2024 | | synonym +2 | Bacteriobiota | | synonym +2 | Monera | Monera | in-part +2 | Procaryotae | Procaryotae | in-part +2 | Prokaryota | Prokaryota | in-part +2 | Prokaryotae | Prokaryotae | in-part +2 | bacteria | bacteria | blast name +2 | bacteria | bacteria | genbank common name +2 | eubacteria | | common name +2 | prokaryote | prokaryote | in-part +2 | prokaryotes | prokaryotes | in-part +543 | Enterobacteraceae | | synonym +543 | Enterobacteraceae (ex Lapage 1979) Lapage 1982 | | authority +543 | Enterobacteriaceae | | scientific name +543 | Enterobacteriaceae (ex Rahn 1937) Ewing et al. 1980 | | authority +543 | Enterobacteriaceae Rahn 1937 (Approved Lists 1980) emend. Adeolu et al. 2016 | | authority +543 | enterobacteria | enterobacteria | blast name +543 | enterobacteria | enterobacteria | genbank common name +543 | gamma-3 proteobacteria | gamma-3 proteobacteria | in-part +548 | "Aerobacter aerogenes" Hormaeche and Edwards 1958 | | authority +548 | ATCC 13048 | ATCC 13048 | type material +548 | Aerobacter aerogenes | | synonym +548 | CCUG 1429 | CCUG 1429 | type material +548 | CIP 60.86 | CIP 60.86 | type material +548 | DSM 30053 | DSM 30053 | type material +548 | Enterobacter aerogenes | | synonym +548 | Enterobacter aerogenes Hormaeche and Edwards 1960 | | authority +548 | HAMBI 101 | HAMBI 101 | type material +548 | HAMBI 1898 | HAMBI 1898 | type material +548 | IFO 13534 | IFO 13534 | type material +548 | JCM 1235 | JCM 1235 | type material +548 | KCTC 2190 | KCTC 2190 | type material +548 | Klebsiella aerogenes | | scientific name +548 | Klebsiella aerogenes (Hormaeche and Edwards 1960) Tindall et al. 2017 | | authority +548 | Klebsiella mobilis | | synonym +548 | Klebsiella mobilis Bascomb et al. 1971 | | authority +548 | LMG 2094 | LMG 2094 | type material +548 | LMG:2094 | LMG:2094 | type material +548 | NBRC 13534 | NBRC 13534 | type material +548 | NCAIM B.01467 | NCAIM B.01467 | type material +548 | NCTC 10006 | NCTC 10006 | type material +568 | Hafnia | | scientific name +568 | Hafnia Moller 1954 | | authority +570 | "Donovania" Anderson et al. 1944 | | authority +570 | "Hyalococcus" Schroeter 1886 | | authority +570 | Calymmatobacterium | | synonym +570 | Calymmatobacterium Aragao and Vianna 1913 | | authority +570 | Donovania | | synonym +570 | Hyalococcus | | synonym +570 | Klebsiella | | scientific name +570 | Klebsiella Trevisan 1885 (Approved Lists 1980) | | authority +570 | Klebsiella Trevisan 1885 (Approved Lists 1980) emend. Carter et al. 1999 | | authority +570 | Klebsiella Trevisan 1885 (Approved Lists 1980) emend. Drancourt et al. 2001 | | authority +570 | Klebsiella Trevisan 1885 (Approved Lists 1980) emend. Ma et al. 2021 | | authority +573 | "Bacillus pneumoniae" (Schroeter 1886) Flugge 1886 | | authority +573 | "Bacterium pneumoniae crouposae" Zopf 1885 | | authority +573 | "Hyalococcus pneumoniae" Schroeter 1886 | | authority +573 | 'Klebsiella aerogenes' (Kruse) Taylor et al. 1956 | | synonym +573 | ATCC 13883 | ATCC 13883 | type material +573 | Bacillus pneumoniae | | synonym +573 | Bacterium pneumoniae crouposae | | synonym +573 | CCUG 225 | CCUG 225 | type material +573 | CDC 298-53 | CDC 298-53 | type material +573 | CIP 82.91 | CIP 82.91 | type material +573 | DSM 30104 | DSM 30104 | type material +573 | HAMBI 450 | HAMBI 450 | type material +573 | Hyalococcus pneumoniae | | synonym +573 | IAM 14200 | IAM 14200 | type material +573 | IFO 14940 | IFO 14940 | type material +573 | JCM 1662 | JCM 1662 | type material +573 | Klebsiella pneumoniae | | scientific name +573 | Klebsiella pneumoniae (Schroeter 1886) Trevisan 1887 | | authority +573 | Klebsiella pneumoniae aerogenes | | synonym +573 | Klebsiella sp. 2N3 | | includes +573 | Klebsiella sp. C1(2016) | | includes +573 | Klebsiella sp. M-AI-2 | | includes +573 | Klebsiella sp. PB12 | | includes +573 | Klebsiella sp. RCE-7 | | includes +573 | LMG 2095 | LMG 2095 | type material +573 | LMG:2095 | LMG:2095 | type material +573 | NBRC 14940 | NBRC 14940 | type material +573 | NCTC 9633 | NCTC 9633 | type material +574 | "Bacillus mucosus azaenae" Abel 1893 | | authority +574 | "Bacillus ozaenae" Abel 1893 | | authority +574 | "Bacterium ozaenae" (Abel 1893) Lehmann and Neumann 1896 | | authority +574 | ATCC 11296 | ATCC 11296 | type material +574 | Bacillus mucosus azaenae | | synonym +574 | Bacillus ozaenae | | synonym +574 | Bacterium ozaenae | | synonym +574 | CCUG 15938 | CCUG 15938 | type material +574 | CIP 52.211 | CIP 52.211 | type material +574 | DSM 16358 | DSM 16358 | type material +574 | JCM 1663 | JCM 1663 | type material +574 | Klebsiella ozaenae | | synonym +574 | Klebsiella ozaenae (Abel 1893) Bergey et al. 1925 (Approved Lists 1980) | | authority +574 | Klebsiella pneumoniae (SUBSP. OZAENAE) | | synonym +574 | Klebsiella pneumoniae ozaenae | | synonym +574 | Klebsiella pneumoniae subsp. ozaenae | | scientific name +574 | Klebsiella pneumoniae subsp. ozaenae (Abel 1893) Orskov 1984 | | authority +574 | Klebsiella sp. VTT E-96667 | | includes +574 | LMG 3113 | LMG 3113 | type material +574 | LMG:3113 | LMG:3113 | type material +574 | NBRC 105683 | NBRC 105683 | type material +574 | NBRC-105683 | NBRC-105683 | type material +574 | NBRC105683 | NBRC105683 | type material +574 | NBRC:105683 | NBRC:105683 | type material +574 | NCTC 5050 | NCTC 5050 | type material +1224 | "Alphaproteobacteriota" Whitman et al. 2018 | | synonym +1224 | "Proteobacteria" Garrity et al. 2005 | | authority +1224 | "Proteobacteriota" Panda et al. 2022 | | authority +1224 | Alphaproteobacteriota | | synonym +1224 | Proteobacteria | | synonym +1224 | Proteobacteria Stackebrandt et al. 1988 | | authority +1224 | Proteobacteriota | | synonym +1224 | Pseudomonadota | | scientific name +1224 | Pseudomonadota corrig. Garrity et al. 2021 | | authority +1224 | proteobacteria | proteobacteria | blast name +1224 | proteobacteria | proteobacteria | genbank common name +1224 | purple photosynthetic bacteria and relatives | | common name +1236 | "Pseudomonadia" Oren et al. 2016 | | authority +1236 | Gammaproteobacteria | | scientific name +1236 | Gammaproteobacteria Garrity et al. 2005 emend. Williams and Kelly 2013 | | authority +1236 | Proteobacteria gamma subdivision | | synonym +1236 | Pseudomonadia | | synonym +1236 | Purple bacteria, gamma subdivision | | synonym +1236 | g-proteobacteria | g-proteobacteria | blast name +1236 | g-proteobacteria | g-proteobacteria | genbank common name +1236 | gamma proteobacteria | | synonym +1236 | gamma subdivision | | synonym +1236 | gamma subgroup | | synonym +2157 | "Archaea" Woese et al. 1990 | | authority +2157 | "Archaebacteria" (sic) Woese and Fox 1977 | | authority +2157 | "Archaebiota" Luketa 2012 | | authority +2157 | Archaea | | scientific name +2157 | Archaea Woese et al. 2024 | | authority +2157 | Archaebacteria | | synonym +2157 | Archaebiota | | synonym +2157 | Mendosicutes | | synonym +2157 | Metabacteria | | synonym +2157 | Monera | Monera | in-part +2157 | Procaryotae | Procaryotae | in-part +2157 | Prokaryota | Prokaryota | in-part +2157 | Prokaryotae | Prokaryotae | in-part +2157 | archaea | | blast name +2157 | prokaryote | prokaryote | in-part +2157 | prokaryotes | prokaryotes | in-part +2235 | "Haloarchaeales" DasSarma and DasSarma 2008 | | authority +2235 | Haloarchaeales | | synonym +2235 | Halobacteriales | | scientific name +2235 | Halobacteriales Grant and Larsen 1989 | | authority +2235 | Halobacteriales Grant and Larsen 1989 emend. Gupta et al. 2015 | | authority +2235 | Haloferacales | | synonym +2235 | Haloferacales Gupta et al. 2015 | | authority +2235 | Natrialbales | | synonym +2235 | Natrialbales Gupta et al. 2015 | | authority +2759 | Eucarya | | synonym +2759 | Eucaryotae | | synonym +2759 | Eukarya | | synonym +2759 | Eukaryota | | scientific name +2759 | Eukaryotae | | synonym +2759 | eukaryotes | eukaryotes | blast name +2759 | eukaryotes | eukaryotes | genbank common name +2763 | Rhodophyceae | | synonym +2763 | Rhodophycota | | synonym +2763 | Rhodophyta | | scientific name +2763 | algae | algae | in-part +2763 | red algae | red algae | blast name +2763 | red algae | red algae | genbank common name +2763 | rhodophytes | | common name +2781 | Gracilariopsis | | scientific name +2781 | Gracilariopsis E.Y.Dawson, 1949 | | authority +2806 | Florideophyceae | | scientific name +2806 | Florideophycideae | | synonym +2870 | Chromophycota | | synonym +2870 | Fucophyceae | | synonym +2870 | Phaeophyceae | | scientific name +2870 | Phaeophyta | | synonym +2870 | algae | algae | in-part +2870 | brown algae | brown algae | blast name +2870 | brown algae | brown algae | genbank common name +2886 | Laminariales | | scientific name +2887 | Alariaceae | | scientific name +2888 | Alaria | Alaria | scientific name +3041 | Chlorophycota | | synonym +3041 | Chlorophyta | | scientific name +3041 | Chlorophyta Pascher, 1914 | | authority +3041 | Chlorophyta sensu Bremer 1985 | | synonym +3041 | Prasinophyceae | | includes +3041 | algae | algae | in-part +3041 | green algae | green algae | blast name +3041 | green algae | green algae | genbank common name +3041 | prasinophyte clade VII | | includes +3041 | prasinophytes | prasinophytes | in-part +3166 | Chlorophyceae | | scientific name +3166 | Chlorophyceae Christensen, 1994 | | authority +3176 | Zygnematales | | scientific name +3176 | Zygnematales C.E.Bessey, 1907 | | authority +3178 | Zygnemataceae | | scientific name +3178 | Zygnemataceae Kuetzing, 1843 | | authority +3193 | Embryophyta | | scientific name +3193 | higher plants | | common name +3193 | land plants | land plants | blast name +3193 | land plants | land plants | genbank common name +3193 | plants | | common name +3208 | Bryophyta | | scientific name +3208 | Musci | | synonym +3208 | bryophytes | bryophytes | in-part +3208 | mosses | mosses | blast name +3208 | mosses | mosses | genbank common name +3214 | Bryopsida | | scientific name +3214 | Bryopsida Pax, 1900 | | authority +3296 | Cycadophyta | | equivalent name +3296 | Cycadopsida | | scientific name +3296 | cycads | | genbank common name +3297 | Cycadales | | scientific name +3297 | Cycadales Pers. ex Bercht. & J.Presl, 1820 | | authority +3313 | Coniferales | | synonym +3313 | Pinidae | | scientific name +3313 | Pinidae Cronquist, Takht. & Zimmerm., 1966 | | authority +3394 | Cycadaceae | | scientific name +3394 | Cycadaceae Pers., 1807 | | authority +3395 | Cycas | | scientific name +3395 | Cycas L. | | authority +3395 | Epicycas | | synonym +3395 | Epicycas de Laub. | | authority +3398 | Angiospermae | | synonym +3398 | Magnoliophyta | | synonym +3398 | Magnoliopsida | | scientific name +3398 | angiosperms | | common name +3398 | flowering plants | flowering plants | blast name +3398 | flowering plants | flowering plants | genbank common name +3400 | Magnoliales | | scientific name +3400 | Magnoliales Bromhead, 1838 | | authority +3400 | Magnolianae | | in-part +3400 | Magnoliineae | | includes +3401 | Magnoliaceae | | scientific name +3401 | Magnoliaceae Juss., 1789 | | authority +3401 | magnolia family | | common name +3402 | Alcimandra | | synonym +3402 | Alcimandra Dandy, 1927 | | authority +3402 | Aromadendron | | synonym +3402 | Aromadendron Blume, 1825 | | authority +3402 | Dugandiodendron | | synonym +3402 | Dugandiodendron Lozano, 1975 | | authority +3402 | Elmerrillia | | synonym +3402 | Elmerrillia Dandy, 1927 | | authority +3402 | Kmeria | | synonym +3402 | Kmeria Dandy, 1927 | | authority +3402 | Lirianthe | | synonym +3402 | Lirianthe Spach, 1839 | | authority +3402 | Magnolia | | scientific name +3402 | Magnolia L., 1753 | | authority +3402 | Michelia | | synonym +3402 | Michelia L., 1753 | | authority +3402 | Pachylarnax | | synonym +3402 | Pachylarnax Dandy, 1927 | | authority +3402 | Parakmeria | | synonym +3402 | Parakmeria Hu & W.C.Cheng, 1951 | | authority +3402 | Talauma | | synonym +3402 | Talauma Juss., 1789 | | authority +3402 | Tsoongiodendron | | includes +3440 | Ranunculaceae | | scientific name +3440 | Ranunculaceae Juss., 1789 | | authority +3440 | buttercup family | | common name +3487 | Moraceae | | scientific name +3487 | Moraceae Gaudich., 1835 | | authority +3487 | mulberry family | | common name +3502 | Casuarinales | | includes +3502 | Casuarinales Bercht. & J. Presl, 1820 | | authority +3502 | Fagales | | scientific name +3502 | Fagales Engl., 1892 | | authority +3502 | Juglandales | | includes +3502 | Juglandales Bercht. & J. Presl, 1820 | | authority +3502 | Myricineae | | includes +3503 | Fagaceae | | scientific name +3503 | Fagaceae Dumort., 1829 | | authority +3503 | beech family | | common name +3511 | Quercus | | scientific name +3511 | Quercus L. | | authority +3524 | Caryophyllales | | scientific name +3524 | Caryophyllales Juss. ex Bercht. & J.Presl, 1820 | | authority +3524 | Centrospermae | | synonym +3524 | Nepenthineae | | includes +3524 | Physenales | | includes +3524 | Polygonales | | includes +3650 | Cucurbitaceae | | scientific name +3650 | Cucurbitaceae Juss., 1789 | | authority +3650 | cucumber family | | common name +3669 | Luffa | | scientific name +3669 | Luffa Mill., 1754 | | authority +3744 | Rhamnales | | includes +3744 | Rosales | | scientific name +3744 | Rosales Bercht. & J.Presl, 1820 | | authority +3744 | Rosanae | | includes +3744 | Urticales | | includes +3745 | Malaceae | | synonym +3745 | Malaceae Sm., 1903 | | authority +3745 | Rosaceae | | scientific name +3745 | Rosaceae Juss., 1789 | | authority +3745 | rose family | | common name +3764 | Rosa | | scientific name +3764 | Rosa L., 1753 | | authority +3803 | Fabaceae | | scientific name +3803 | Fabaceae Lindl., 1836 | | authority +3803 | Leguminosae | | synonym +3803 | pea family | | common name +3814 | Faboideae | | synonym +3814 | Faboideae Rudd, 1968 | | authority +3814 | Papilionoideae | | scientific name +3841 | Erythrina | | scientific name +3841 | Erythrina L. | | authority +4011 | Anacardiaceae | | scientific name +4011 | Anacardiaceae R.Br., 1818 | | authority +4011 | sumac family | | common name +4036 | Apiales | | scientific name +4036 | Apiales Nakai, 1930 | | authority +4036 | Araliales | | synonym +4036 | Araliales Juss. ex Bercht. & J.Presl, 1820 | | authority +4037 | Apiaceae | | scientific name +4037 | Apiaceae Lindl., 1836 | | authority +4037 | Umbelliferae | | synonym +4037 | carrot family | | common name +4055 | Gentianales | | scientific name +4055 | Gentianales Juss. ex Bercht. & J.Presl, 1820 | | authority +4143 | Lamiales | | scientific name +4143 | Lamiales Bromhead, 1838 | | authority +4143 | Scrophulariales | | includes +4149 | Buddlejaceae | | includes +4149 | Buddlejaceae K.Wilh., 1910 | | authority +4149 | Myoporaceae | | includes +4149 | Myoporaceae R.Br., 1810 | | authority +4149 | Scrophulariaceae | Scrophulariaceae | scientific name +4149 | Scrophulariaceae Juss., 1789 | | authority +4149 | Selaginaceae | | includes +4149 | Selaginaceae Choisy, 1823 | | authority +4149 | figwort family | | common name +4199 | Dipsacales | | scientific name +4199 | Dipsacales Juss. ex Bercht. & J.Presl, 1820 | | authority +4200 | Caprifoliaceae | | scientific name +4200 | Caprifoliaceae Juss., 1789 | | authority +4200 | honeysuckle famly | | common name +4209 | Asterales | | scientific name +4209 | Asterales Link, 1829 | | authority +4209 | Campanulales | | includes +4210 | Asteraceae | | scientific name +4210 | Asteraceae Bercht. & J.Presl, 1820 | | authority +4210 | Compositae | | equivalent name +4210 | daisy family | | common name +4231 | Helianthus | | scientific name +4231 | Helianthus L., 1753 | | authority +4231 | sunflowers | | common name +4321 | Icacinaceae | Icacinaceae | scientific name +4321 | Icacinaceae Miers, 1851 | | authority +4447 | Liliopsida | | scientific name +4447 | Monocotyledoneae | | synonym +4447 | monocots | monocots | blast name +4447 | monocots | monocots | genbank common name +4447 | monocotyledons | | common name +4454 | Araceae | | scientific name +4454 | Araceae Juss., 1789 | | authority +4454 | Lemnaceae | | includes +4454 | arum family | | common name +4479 | Bambusaceae | | synonym +4479 | Bambusaceae Nakai, 1943 | | authority +4479 | Gramineae | | synonym +4479 | Poaceae | | scientific name +4479 | Poaceae Barnhart, 1895 | | authority +4479 | grass family | | common name +4496 | Avena | | scientific name +4496 | Avena L., 1753 | | authority +4500 | Avena longiglumis | | scientific name +4500 | Avena longiglumis Durieu, 1845 | | authority +4523 | Neurachne | | scientific name +4523 | Neurachne R.Br. | | authority +4581 | Bambusa | | scientific name +4581 | Bambusa Schreb. | | authority +4581 | bamboos | | genbank common name +4667 | Liliales | | scientific name +4667 | Liliales Perleb, 1826 | | authority +4667 | Liliales/Asparagales group | Liliales/Asparagales group | in-part +4667 | Liliiflorae | Liliiflorae | in-part +4667 | Orchidales | | includes +4734 | Commelinidae | | synonym +4734 | Commeliniflorae | | synonym +4734 | commelinids | | scientific name +4747 | Orchidaceae | | scientific name +4747 | Orchidaceae Juss., 1789 | | authority +4747 | orchid family | | common name +4751 | Fungi | | scientific name +4751 | Mycota | | synonym +4751 | fungi | | blast name +4762 | Oomycetes | | synonym +4762 | Oomycetes G. Winter, 1880 | | authority +4762 | Oomycota | | scientific name +4762 | Oomycota Arx, 1967 | | authority +4762 | oomycetes | | blast name +4763 | Saprolegniales | | scientific name +4763 | Saprolegniales Prantl, 1874 | | authority +4764 | Saprolegniaceae | | scientific name +4769 | Saprolegnia | | scientific name +4890 | Ascomycota | | scientific name +4890 | ascomycete fungi | ascomycete fungi | blast name +4890 | ascomycete fungi | ascomycete fungi | genbank common name +4890 | sac fungi | | common name +4958 | Debaryomyces | | scientific name +4958 | Debaryomyces Lodder & Kreger-van Rij ex Kreger-van Rij, 1984 | | authority +4958 | Wingea | | synonym +4972 | ATCC 24291 | ATCC 24291 | type material +4972 | Bullera armeniaca | | synonym +4972 | CBS 4214 | CBS 4214 | type material +4972 | CCRC 21600 | CCRC 21600 | type material +4972 | CCRC:21600 | CCRC:21600 | type material +4972 | Cryptococcus hungaricus | | synonym +4972 | Cryptococcus sp. GU67 | | includes +4972 | DBVPG 7152 | DBVPG 7152 | type material +4972 | Dioszegia hungarica | | scientific name +4972 | Dioszegia hungarica Zsolt, 1957 | | authority +4972 | IFO 1052 | IFO 1052 | type material +4972 | IGC 3954 | IGC 3954 | type material +4972 | JCM 9046 | JCM 9046 | type material +4972 | MUCL 30660 | MUCL 30660 | type material +4972 | NRRL Y-6667 | NRRL Y-6667 | type material +4972 | UCD 68-187 | UCD 68-187 | type material +4972 | specimen-voucher:NRRL:Y:6667 | specimen-voucher:NRRL:Y:6667 | type material +5036 | Histoplasma | | scientific name +5036 | Histoplasma Darling, 1906 | | authority +5037 | ATCC 22635 [[Emmonsiella capsulata]] | ATCC 22635 [[Emmonsiella capsulata]] | type material +5037 | Ajellomyces capsulatus (Kwon-Chung) McGinnis & Katz, 1979 | | synonym +5037 | CBS 136.72 [[Emmonsiella capsulata]] | CBS 136.72 [[Emmonsiella capsulata]] | type material +5037 | Cryptococcus capsulatus | | synonym +5037 | Cryptococcus capsulatus (Darling) Castell. & Chalm., 1919 | | authority +5037 | Emmonsiella capsulata | | synonym +5037 | Emmonsiella capsulata Kwon-Chung, 1972 | | authority +5037 | Histoplasma capsulatum | | scientific name +5037 | Histoplasma capsulatum Darling, 1906 | | authority +5039 | ATCC 18188 | ATCC 18188 | type material +5039 | Ajellomyces dermatitidis | | synonym +5039 | Ajellomyces dermatitidis McDonough & A.L. Lewis, 1968 | | authority +5039 | Blastomyces dermatitidis | | scientific name +5039 | Blastomyces dermatitidis Gilchrist & W.R. Stokes, 1898 | | authority +5039 | Blastomycoides dermatitidis | | synonym +5039 | CBS 674.68 | CBS 674.68 | type material +5039 | UAMH 3539 | UAMH 3539 | type material +5039 | UAMH-3539 | UAMH-3539 | type material +5039 | UAMH3539 | UAMH3539 | type material +5039 | UAMH:3539 | UAMH:3539 | type material +5125 | Hypocreales | | scientific name +5125 | Hypocreales Lindau, 1897 | | authority +5125 | Pyrenomycetes | Pyrenomycetes | in-part +5139 | Sordariales | | scientific name +5139 | Sordariales Chadef. ex D. Hawksw. & O.E. Erikss., 1986 | | authority +5149 | Chaetomium | | scientific name +5149 | Chaetomium Kunze, 1817 | | authority +5197 | Lecanorales | | scientific name +5197 | Lecanorales Nannf., 1932 | | authority +5198 | Cladiaceae | | includes +5198 | Cladoniaceae | | scientific name +5198 | Cladoniaceae Zenker, 1827 | | authority +5199 | Cladina | | includes +5199 | Cladina (Nyl.) Nyl., 1866 | | authority +5199 | Cladonia | | scientific name +5204 | Basidiomycota | | scientific name +5204 | basidiomycete fungi | basidiomycete fungi | blast name +5204 | basidiomycete fungi | basidiomycete fungi | genbank common name +5204 | basidiomycetes | | common name +5234 | Christianseniales | | includes +5234 | Tremellales | | scientific name +5234 | Tremellales Fr., 1821 | | authority +5234 | anamorphic Tremellales | | includes +5234 | jelly fungi | | genbank common name +5234 | mitosporic Tremellales | | includes +5302 | Agaricomycotina | | scientific name +5302 | Agaricomycotina Doweld, 2001 | | authority +5302 | Hymenomycetes | | equivalent name +5303 | Aphyllophorales | | synonym +5303 | Polyporales | | scientific name +5303 | Polyporales Gaum., 1926 | | authority +5303 | anamorphic Aphyllophorales | | includes +5303 | anamorphic Polyporales | | includes +5303 | mitosporic Aphyllophorales | | includes +5303 | mitosporic Polyporales | | includes +5305 | Phanerochaete | | scientific name +5305 | Phanerochaete P. Karst., 1889 | | authority +5314 | Ganoderma | | scientific name +5314 | Ganoderma P. Karst., 1881 | | authority +5314 | Magoderna | | synonym +5314 | Magoderna Steyaert, 1972 | | authority +5317 | Coriolaceae | | synonym +5317 | Cryptoporaceae | | synonym +5317 | Echinochaetaceae | | synonym +5317 | Fomitaceae | | synonym +5317 | Ganodermataceae | | synonym +5317 | Grammotheleaceae | | synonym +5317 | Haddowiaceae | | synonym +5317 | Lentinaceae | | synonym +5317 | Lentinaceae Julich | | synonym +5317 | Lophariaceae | | synonym +5317 | Microporaceae | | synonym +5317 | Pachykytosporaceae | | synonym +5317 | Perenniporiaceae | | synonym +5317 | Polyporaceae | | scientific name +5317 | Sparsitubaceae | | synonym +5317 | Trametaceae | | synonym +5317 | bracket fungi | | genbank common name +5338 | Agaricales | | scientific name +5338 | Agaricales Underw., 1899 | | authority +5338 | Agaricales anamorphs | | synonym +5338 | Hymenogastrales | | synonym +5338 | Lycoperdales | | synonym +5338 | Nidulariales | | synonym +5338 | Tulostomatales | | synonym +5338 | anamorphic Agaricales | | synonym +5338 | gasteromycetes | gasteromycetes | includes +5338 | gill mushrooms | | genbank common name +5338 | mitosporic Agaricales | | includes +5455 | Colletotrichum | | scientific name +5455 | Colletotrichum Corda, 1831 | | authority +5455 | Glomerella | Glomerella | synonym +5455 | Glomerella Spauld. & H. Schrenk 1903 | | authority +5500 | Coccidioides | | scientific name +5500 | Coccidioides C.W. Stiles, 1896 | | authority +5501 | CBS 120936 | CBS 120936 | type material +5501 | CBS 144.34 | CBS 144.34 | type material +5501 | CBS H-19842 | CBS H-19842 | type material +5501 | Coccidioides immitis | | scientific name +5501 | Coccidioides immitis G.W. Stiles, 1896 | | authority +5501 | RMSCC 2394 | RMSCC 2394 | type material +5506 | Albonectria | | synonym +5506 | Albonectria Rossman & Samuels, 1999 | | authority +5506 | Bisifusarium | | synonym +5506 | Bisifusarium L. Lombard, Crous & W. Gams, 2015 | | authority +5506 | Cyanonectria | | synonym +5506 | Cyanonectria Samuels & P. Chaverri, 2009 | | authority +5506 | Fusarium | | scientific name +5506 | Fusarium Link, 1809 | | authority +5506 | Fusarium sect. Setofusarium | | synonym +5506 | Fusarium sect. Setofusarium Nirenberg & Samuels, 1989 | | authority +5506 | Fusisporium | | synonym +5506 | Fusisporium Link, 1809 | | authority +5506 | Geejayessia | | synonym +5506 | Geejayessia Schroers, Grafenhan & Seifert, 2011 | | authority +5506 | Gibberella | | synonym +5506 | Gibberella Sacc., 1877 | | authority +5506 | Haematonectria | | synonym +5506 | Haematonectria Samuels & Nirenberg, 1999 | | authority +5506 | Luteonectria | | synonym +5506 | Luteonectria Sand.-Den., L. Lombard, Schroers & Rossman, 2021 | | synonym +5506 | Neocosmospora | | synonym +5506 | Neocosmospora E.F. Sm., 1899 | | authority +5506 | Nothofusarium | | synonym +5506 | Nothofusarium Crous, Sand.-Den. & L. Lombard, 2021 | | authority +5506 | Rectifusarium | | synonym +5506 | Rectifusarium L. Lombard, Crous & W. Gams, 2015 | | authority +5506 | Setofusarium | | synonym +5506 | Setofusarium (Nirenberg & Samuels) Crous & Sand.-Den., 2021 | | authority +5550 | Bodinia | | synonym +5550 | Bodinia M. Ota & Langeron, 1923 | | authority +5550 | Grubyella | | synonym +5550 | Grubyella M. Ota & Langeron, 1923 | | authority +5550 | Trichophyton | | scientific name +5550 | Trichophyton Malmsten, 1848 | | authority +5551 | ATCC 32871 [[Trichophyton fischeri]] | ATCC 32871 [[Trichophyton fischeri]] | type material +5551 | ATCC 42631 [[Trichophyton raubitschekii]] | ATCC 42631 [[Trichophyton raubitschekii]] | type material +5551 | ATCC 62345 [[Trichophyton kanei]] | ATCC 62345 [[Trichophyton kanei]] | type material +5551 | CBS 100081 [[Trichophyton fischeri]] | CBS 100081 [[Trichophyton fischeri]] | type material +5551 | CBS 100084 [[Trichophyton raubitschekii]] | CBS 100084 [[Trichophyton raubitschekii]] | type material +5551 | CBS 289.86 [[Trichophyton kanei]] | CBS 289.86 [[Trichophyton kanei]] | type material +5551 | CBS 392.58 | CBS 392.58 | type material +5551 | Epidermophyton rubrum | | synonym +5551 | Epidermophyton rubrum Castell., 1910 | | authority +5551 | IMI 213848 [[Trichophyton fischeri]] | IMI 213848 [[Trichophyton fischeri]] | type material +5551 | Microsporum rubrum | | synonym +5551 | Microsporum rubrum Cazalbou, 1913 | | authority +5551 | Sabouraudites ruber | | synonym +5551 | Sabouraudites ruber (Cazalbou) Nann., 1934 | | synonym +5551 | TRTC 50887 [[Trichophyton kanei]] | TRTC 50887 [[Trichophyton kanei]] | type material +5551 | Trichophyton fischeri | | synonym +5551 | Trichophyton fischeri J. Kane, 1977 | | authority +5551 | Trichophyton kanei | | synonym +5551 | Trichophyton kanei Summerb., 1987 | | authority +5551 | Trichophyton megninii | | synonym +5551 | Trichophyton megninii R. Blanch., 1895 | | authority +5551 | Trichophyton raubitschekii | | synonym +5551 | Trichophyton raubitschekii J. Kane, Salkin, Weitzman & Smitka, 1981 | | authority +5551 | Trichophyton rubrum | | scientific name +5551 | Trichophyton rubrum (Castell.) Sabour., 1911 | | authority +5551 | Trichophyton rubrum var. raubitschekii | | synonym +5794 | Apicomplexa | | scientific name +5794 | Apicomplexa Levine 1980, emend. Adl et al. 2005 | | authority +5794 | apicomplexans | apicomplexans | blast name +5794 | apicomplexans | apicomplexans | genbank common name +5796 | Coccidia | | scientific name +5796 | coccidians | | synonym +5809 | Sarcocystidae | | scientific name +5809 | Sarcocystids | | synonym +5819 | Haemosporida | | scientific name +5819 | Haemosporina | | synonym +5819 | Haemospororida | | synonym +5819 | haemosporidians | | genbank common name +5820 | Plasmodium | Plasmodium | scientific name +5820 | Saurocytozoon | | synonym +5825 | Plasmodium chabaudi | | scientific name +5857 | Plasmodium fragile | | scientific name +5860 | Plasmodium vinckei | | scientific name +5860 | Plasmodium vinckei (Rodhain, 1952) | | authority +5863 | Piroplasmida | | scientific name +5863 | Piroplasmids | | genbank common name +5872 | Babesia equi | | synonym +5872 | Babesia equi Laveran, 1901 | | authority +5872 | Theileria equi | | scientific name +5872 | Theileria equi (Laveran, 1901) Mehlhorn & Schein 1998 | | authority +5873 | Theileria | | scientific name +5873 | Theileria Bettencourt et al. 1907 | | authority +5874 | Theileria annulata | | scientific name +6072 | Eumetazoa | | scientific name +6073 | Cnidaria | | scientific name +6073 | Coelenterata | Coelenterata | in-part +6073 | cnidarians | cnidarians | blast name +6073 | cnidarians | cnidarians | genbank common name +6073 | coelenterates | coelenterates | common name +6101 | Anthozoa | | scientific name +6101 | anthozoans | anthozoans | blast name +6101 | anthozoans | anthozoans | genbank common name +6102 | Ceriantipatharia | | includes +6102 | Hexacorallia | | scientific name +6125 | Madreporaria | | synonym +6125 | Scleractinia | | scientific name +6125 | stony corals | stony corals | blast name +6125 | stony corals | stony corals | genbank common name +6126 | Acroporidae | | scientific name +6127 | Acropora | | scientific name +6127 | staghorn corals | | genbank common name +6157 | Neorhabdocoela | | includes +6157 | Platyhelminthes | | scientific name +6157 | Proplicastomata | | includes +6157 | Turbellaria | | includes +6157 | Turbellarian Platyhelminths | | includes +6157 | flatworm | | common name +6157 | flatworms | flatworms | blast name +6157 | flatworms | flatworms | genbank common name +6159 | Tricladida | | scientific name +6199 | Cestoda | | scientific name +6199 | tapeworms | | genbank common name +6200 | Eucestoda | | scientific name +6217 | Nemertea | | scientific name +6217 | Nemertini | | synonym +6217 | bootlace worms | | common name +6217 | nemertines | | common name +6217 | ribbon worms | ribbon worms | blast name +6217 | ribbon worms | ribbon worms | genbank common name +6218 | Anopla | | synonym +6218 | Pilidiophora | | scientific name +6219 | Heteronemertea | | scientific name +6219 | Heteronemertini | | synonym +6219 | heteronemertine worms | | genbank common name +6222 | Cerebratulidae | | synonym +6222 | Lineidae | | scientific name +6231 | Nemata | | synonym +6231 | Nematoda | | scientific name +6231 | nematode | | common name +6231 | nematodes | nematodes | blast name +6231 | nematodes | nematodes | genbank common name +6231 | roundworm | | common name +6231 | roundworms | | common name +6236 | Rhabditida | | scientific name +6236 | Strongylida | | synonym +6249 | Ascaridida | | synonym +6249 | Ascaridomorpha | | scientific name +6267 | Anisakidae | | scientific name +6274 | Spirurida | | synonym +6274 | Spirurina | | scientific name +6447 | Mollusca | | scientific name +6447 | molluscs | molluscs | blast name +6447 | molluscs | molluscs | genbank common name +6447 | mollusks | | common name +6544 | Bivalvia | | scientific name +6544 | Lamellibranchiata | | synonym +6544 | Pelecypoda | | synonym +6544 | bivalves | bivalves | blast name +6544 | bivalves | bivalves | genbank common name +6599 | Heteroconchia | | scientific name +6656 | Arthropoda | | scientific name +6656 | arthropods | arthropods | blast name +6656 | arthropods | arthropods | genbank common name +6657 | Crustacea | | scientific name +6657 | crustaceans | crustaceans | blast name +6657 | crustaceans | crustaceans | genbank common name +6681 | Malacostraca | | scientific name +6682 | Eucarida | | scientific name +6683 | Decapoda | | scientific name +6692 | Pleocyemata | | scientific name +6712 | Astacidea | | scientific name +6712 | Astacura | | synonym +6712 | true lobsters and crayfishes | | genbank common name +6738 | Anomura | | scientific name +6738 | hermit crabs | hermit crabs | genbank common name +6744 | Coenobitoidea | | includes +6744 | Paguroidea | | scientific name +6745 | Paguridae | | scientific name +6746 | Pagurus | | scientific name +6746 | hermit crabs | hermit crabs | common name +6752 | Brachyura | | scientific name +6752 | short-tailed crabs | | genbank common name +6752 | true crabs | | common name +6960 | Atelocerata | Atelocerata | in-part +6960 | Hexapoda | | scientific name +6960 | Tracheata | Tracheata | in-part +6960 | Uniramia | Uniramia | in-part +6960 | hexapods | hexapods | blast name +6960 | hexapods | hexapods | genbank common name +6961 | Odonata | | scientific name +6961 | dragonflies & damselflies | dragonflies & damselflies | blast name +6961 | dragonflies & damselflies | dragonflies & damselflies | genbank common name +6970 | Dictyoptera | Dictyoptera | scientific name +6993 | Orthoptera | | scientific name +6993 | Saltatoria | | synonym +6993 | grasshoppers, crickets & katydids | grasshoppers, crickets & katydids | blast name +6993 | grasshoppers, crickets & katydids | grasshoppers, crickets & katydids | genbank common name +6994 | Ensifera | Ensifera | scientific name +6994 | crickets & katydids | | genbank common name +7041 | Coleoptera | | scientific name +7041 | beetles | beetles | blast name +7041 | beetles | beetles | genbank common name +7042 | Curculionidae | | scientific name +7042 | weevils | | genbank common name +7088 | Lepidoptera | | scientific name +7088 | moths & butterflies | moths & butterflies | blast name +7088 | moths & butterflies | moths & butterflies | genbank common name +7089 | Bombycidae | | scientific name +7089 | silkworm moths | | genbank common name +7100 | Noctuidae | | scientific name +7100 | noctuid moths | | common name +7100 | owlet moths | | genbank common name +7147 | Diptera | | scientific name +7147 | flies | flies | blast name +7147 | flies | flies | genbank common name +7148 | Nematocera | | scientific name +7157 | Culicidae | | scientific name +7157 | mosquitos | mosquitos | blast name +7157 | mosquitos | mosquitos | genbank common name +7158 | Aedes | Aedes | scientific name +7399 | Hymenoptera | | scientific name +7399 | hymenopterans | hymenopterans | blast name +7399 | hymenopterans | hymenopterans | genbank common name +7400 | Apocrita | | scientific name +7400 | wasps, ants & bees | wasps, ants & bees | blast name +7400 | wasps, ants & bees | wasps, ants & bees | common name +7401 | Ichneumonoidea | | scientific name +7402 | Braconidae | | scientific name +7434 | Aculeata | Aculeata | scientific name +7434 | Aculeata Latreille, 1802 | | authority +7458 | Apidae | | scientific name +7458 | bumble bees and honey bees | | genbank common name +7459 | Apis | | scientific name +7496 | Pterygota | Pterygota | scientific name +7496 | winged insects | | genbank common name +7516 | Neuroptera | | scientific name +7516 | Planipennia | | synonym +7516 | lacewings | | common name +7516 | net-winged insects | | genbank common name +7524 | Hemiptera | | scientific name +7524 | Homoptera | | includes +7524 | true bugs | true bugs | blast name +7524 | true bugs | true bugs | genbank common name +7581 | Comatulida | | scientific name +7586 | Echinodermata | | scientific name +7586 | echinoderms | echinoderms | blast name +7586 | echinoderms | echinoderms | genbank common name +7711 | Chordata | | scientific name +7711 | chordates | chordates | blast name +7711 | chordates | chordates | genbank common name +7742 | Vertebrata | Vertebrata | scientific name +7742 | Vertebrata Cuvier, 1812 | | authority +7742 | vertebrates | vertebrates | blast name +7742 | vertebrates | vertebrates | genbank common name +7776 | Gnathostomata | Gnathostomata | scientific name +7776 | jawed vertebrates | | genbank common name +7777 | Chondrichthyes | | scientific name +7777 | cartilaginous fishes | cartilaginous fishes | blast name +7777 | cartilaginous fishes | cartilaginous fishes | genbank common name +7777 | fish | fish | common name +7777 | fishes | fishes | common name +7778 | Elasmobranchii | | scientific name +7778 | elasmobranchs | | common name +7778 | sharks & rays | sharks & rays | blast name +7778 | sharks & rays | sharks & rays | genbank common name +7898 | Actinopterygi | | synonym +7898 | Actinopterygii | | scientific name +7898 | Osteichthyes | Osteichthyes | in-part +7898 | fish | fish | common name +7898 | fishes | fishes | common name +7898 | ray-finned fishes | ray-finned fishes | blast name +7898 | ray-finned fishes | ray-finned fishes | genbank common name +7952 | Cypriniformes | | scientific name +7952 | carps and others | | genbank common name +7953 | Cyprinidae | | scientific name +7982 | Cobitidae | | scientific name +7982 | loaches | | genbank common name +7983 | Misgurnus | | scientific name +8006 | Salmoniformes | | scientific name +8006 | salmons and trouts | | genbank common name +8015 | Salmonidae | | scientific name +8015 | salmonids | | genbank common name +8033 | Salvelinus | | scientific name +8034 | NHMW:91214 | NHMW:91214 | type material +8034 | NMW:91214 | NMW:91214 | type material +8034 | NMW:91214 | NMW:91214 | type material +8034 | Salmo leucomaenis | | synonym +8034 | Salmo leucomaenis Pallas, 1814 | | authority +8034 | Salvelinus leucomaenis | | scientific name +8034 | Salvelinus leucomaenis (Pallas, 1814) | | authority +8034 | ZMB:23552 | ZMB:23552 | type material +8034 | ZMB:23563 | ZMB:23563 | type material +8034 | amemasu char | | common name +8034 | whitespotted char | | genbank common name +8035 | Salmo pluvius | | synonym +8035 | Salmo pluvius Hilgendorf, 1876 | | authority +8035 | Salvelinus leucomaenis pluvius | | scientific name +8035 | Salvelinus pluvius | | synonym +8111 | Perciformes | | scientific name +8111 | Scorpaeniformes | | synonym +8111 | Serraniformes | | synonym +8111 | perches and others | | genbank common name +8113 | Cichlidae | | scientific name +8113 | cichlids | | genbank common name +8205 | Notothenioidei | | scientific name +8219 | Gobioidei | | scientific name +8220 | Gobiidae | | scientific name +8220 | Microdesmidae | | synonym +8220 | Trypauchenidae | | synonym +8220 | burrowing gobies | | common name +8220 | gobies | | genbank common name +8220 | wormfishes | | common name +8252 | Pleuronectiformes | | scientific name +8252 | flatfishes | | genbank common name +8256 | Pleuronectidae | | scientific name +8256 | righteye flounders | | genbank common name +8287 | Sarcopterygii | | scientific name +8292 | Amphibia | | scientific name +8292 | Lissamphibia | | includes +8292 | amphibians | amphibians | blast name +8292 | amphibians | amphibians | genbank common name +8293 | Caudata | | scientific name +8293 | Urodela | | synonym +8293 | salamanders | salamanders | blast name +8293 | salamanders | salamanders | genbank common name +8294 | Ambystomatidae | | scientific name +8294 | mole salamanders | mole salamanders | genbank common name +8295 | Ambystoma | | scientific name +8295 | big salamanders | | common name +8295 | mole salamanders | mole salamanders | genbank common name +8306 | Ambystoma talpoideum | | scientific name +8306 | Ambystoma talpoideum (Holbrook, 1838) | | authority +8306 | Salamandra talpoidea | | synonym +8306 | Salamandra talpoidea Holbrook, 1838 | | authority +8306 | mole salamander | | genbank common name +8342 | Anura | | scientific name +8342 | Salientia | | synonym +8342 | anurans | | common name +8342 | frogs | | common name +8342 | frogs & toads | frogs & toads | blast name +8342 | frogs & toads | frogs & toads | genbank common name +8416 | Neobatrachia | | scientific name +8426 | Microhyloidea | | scientific name +8427 | Microhylidae | | scientific name +8427 | microhylid toads | | genbank common name +8457 | Sauropsida | | scientific name +8457 | sauropsids | | genbank common name +8492 | Archosauria | | scientific name +8782 | Aves | | scientific name +8782 | avian | | synonym +8782 | birds | birds | blast name +8782 | birds | birds | genbank common name +8825 | Neognathae | | scientific name +8826 | Anseriformes | | scientific name +8826 | ducks, geese & swans | | genbank common name +8827 | Anhimidae | | scientific name +8827 | screamers | | genbank common name +8828 | Chauna | | scientific name +8906 | Charadriiformes | | scientific name +8906 | Turniciformes | | includes +8906 | shorebirds & allies | | genbank common name +8906 | shorebirds and others | | common name +8936 | Coraciadiformes | | synonym +8936 | Coraciiformes | | scientific name +8936 | kingfishers and others | | genbank common name +8940 | Cuculiformes | | scientific name +8940 | cuckoos and others | | genbank common name +8941 | Cuculidae | | scientific name +8941 | cuckoos | | genbank common name +8948 | Falconiformes | | scientific name +8948 | falcons and others | | genbank common name +8949 | Falconidae | | scientific name +8955 | Accipitrinae | | scientific name +9108 | Gruiformes | | scientific name +9108 | cranes, rails & allies | | genbank common name +9108 | terrestrial and marshbirds | | common name +9126 | Passeriformes | | scientific name +9126 | song birds | | genbank common name +9219 | Galbuliformes | | includes +9219 | Piciformes | | scientific name +9219 | jacamars | | common name +9219 | woodpeckers and others | | genbank common name +9223 | Psittaciformes | | scientific name +9223 | parrots and others | | genbank common name +9224 | Psittacidae | | scientific name +9224 | parrot | | common name +9224 | parrots | | genbank common name +9230 | Sphenisciformes | | scientific name +9230 | penguins | penguins | genbank common name +9231 | Spheniscidae | | scientific name +9231 | penguins | penguins | genbank common name +9239 | Spheniscus | | scientific name +9263 | Marsupialia | | synonym +9263 | Metatheria | | scientific name +9263 | marsupials | marsupials | blast name +9263 | marsupials | marsupials | genbank common name +9265 | American opossums | | common name +9265 | Didelphidae | | scientific name +9265 | opossums | | genbank common name +9266 | Didelphis | | scientific name +9347 | Eutheria | | scientific name +9347 | Placentalia | | synonym +9347 | eutherian mammals | | common name +9347 | placental mammals | | common name +9347 | placentals | placentals | blast name +9347 | placentals | placentals | genbank common name +9397 | Chiroptera | | scientific name +9397 | bats | bats | blast name +9397 | bats | bats | genbank common name +9431 | Vespertilionidae | | scientific name +9431 | common bats | | common name +9431 | vesper bats | | genbank common name +9431 | vespertilionid bats | | common name +9434 | Myotis | | scientific name +9655 | Mustelidae | | scientific name +9655 | weasel, mink, badger, martens and others | | genbank common name +9671 | Pteronura | | scientific name +9672 | Pteronura brasiliensis | | scientific name +9672 | Pteronura brasiliensis Zimmermann, 1780 | | authority +9672 | giant otter | | genbank common name +9681 | Felidae | | scientific name +9681 | cat family | | genbank common name +9688 | Leo | | synonym +9688 | Panthera | | scientific name +9688 | Uncia | | synonym +9690 | Panthera onca | | scientific name +9690 | jaguar | | genbank common name +9845 | Ruminantia | | scientific name +9895 | Bovidae | | scientific name +9918 | Bubalus | | scientific name +9975 | Lagomorpha | | scientific name +9975 | Lagomorpha Brandt, 1855 | | authority +9975 | rabbits & hares | | blast name +9979 | Leporidae | | scientific name +9979 | Leporidae Fischer, 1817 | | authority +9979 | rabbits and hares | | genbank common name +9980 | Lepus | | scientific name +9980 | Lepus Linnaeus, 1758 | | authority +9980 | hares | | genbank common name +9989 | Rodentia | | scientific name +9989 | rodent | | common name +9989 | rodents | rodents | blast name +9989 | rodents | rodents | genbank common name +10045 | Gerbillinae | | scientific name +10045 | gerbils | | genbank common name +10066 | Muridae | | scientific name +10239 | Vira | | synonym +10239 | Viridae | | synonym +10239 | Viruses | | scientific name +10239 | viruses | | blast name +10293 | Alphaherpesvirinae | | scientific name +10293 | Alphaherpesviruses | | common name +10294 | Simplexvirus | | scientific name +10319 | Varicellovirus | | scientific name +10357 | Betaherpesvirinae | | scientific name +10357 | Betaherpesviruses | | common name +10358 | Cytomegalovirus | | scientific name +10374 | Gammaherpesvirinae | | scientific name +10374 | Gammaherpesviruses | | common name +10374 | lymphoproliferative virus group | | genbank common name +10404 | Hepadnaviridae | | scientific name +10404 | hepatitis B-type viruses | | genbank common name +10405 | Orthohepadnavirus | | scientific name +10405 | mammalian hepatitis B-type viruses | | genbank common name +10442 | Baculoviridae | | scientific name +10566 | Human Papilloma Virus | | equivalent name +10566 | Human papillomavirus | | scientific name +10566 | human papillomavirus HPV | | equivalent name +10567 | Iotapapillomavirus 1 | | scientific name +10567 | Mastomys natalensis papillomavirus | | equivalent name +10567 | Multimammate rat papillomavirus | | equivalent name +10567 | Praomys natalensis papillomavirus | | equivalent name +10639 | Caulimovirus | | scientific name +10652 | Badnavirus | | scientific name +10652 | Commelina yellow mottle virus group | | equivalent name +10780 | Parvoviridae | | scientific name +10803 | Dependoparvovirus | | scientific name +10803 | Dependovirus | | equivalent name +10803 | dependoviruses | | common name +10811 | Geminiviridae | | scientific name +10811 | Geminivirus | | equivalent name +10812 | Geminivirus subgroup I | | equivalent name +10812 | Mastrevirus | | scientific name +10812 | Subgroup I Geminivirus | | equivalent name +10814 | Begomovirus | | scientific name +10814 | Geminivirus subgroup III | | equivalent name +10814 | Subgroup III Geminivirus | | equivalent name +10841 | Microviridae | | scientific name +10841 | bacterial virus | bacterial virus | in-part +10841 | bacterial viruses | bacterial viruses | in-part +10841 | isometric ssDNA phages | | genbank common name +10841 | prokaryotic virus | prokaryotic virus | in-part +10882 | Orthoreovirus | | scientific name +10882 | RAM-1 | | acronym +10882 | Reoviruses | | equivalent name +10892 | Orbiviridae | | equivalent name +10892 | Orbivirus | | scientific name +10892 | Orbiviruses | | equivalent name +10979 | Aquareovirus | | scientific name +10988 | Fijivirus | | scientific name +10988 | plant reovirus 2 | | genbank common name +10989 | MRDV | | acronym +10989 | Maize rough dwarf fijivirus | | equivalent name +10989 | Maize rough dwarf virus | | scientific name +10993 | Birnaviridae | | scientific name +11006 | Totiviridae | | scientific name +11006 | monopartite dsRNA genome mycoviruses | | genbank common name +11007 | Totivirus | | scientific name +11012 | Partitiviridae | | scientific name +11050 | Flaviviridae | | scientific name +11050 | Flavivirus (arbovirus group B) | | equivalent name +11095 | Pestivirus | | scientific name +11102 | Hepacivirus | | scientific name +11102 | Hepatitis C virus group | | equivalent name +11102 | Hepatitis C viruses | | equivalent name +11102 | Hepatitis C-like viruses | | equivalent name +11118 | Coronaviridae | | scientific name +11157 | Mononegavirales | | scientific name +11157 | negative-sense genome single-stranded RNA viruses | | genbank common name +11158 | Paramyxoviridae | | scientific name +11229 | Morbillivirus | | scientific name +11229 | Morbilliviruses | | equivalent name +11240 | Phocine distemper virus | | equivalent name +11240 | Phocine morbillivirus | | scientific name +11240 | phocid distemper virus | | equivalent name +11240 | phocid distemper virus PDV | | equivalent name +11240 | phocine distemper virus PDV | | equivalent name +11270 | Rhabdoviridae | | scientific name +11271 | Vesiculovirus | | scientific name +11308 | Orthomyxoviridae | | scientific name +11318 | Dhori thogotovirus | | equivalent name +11318 | Dhori virus | | equivalent name +11318 | Thogotovirus dhoriense | | scientific name +11318 | Tick-borne virus | | equivalent name +11319 | Dhori virus (strain Indian/1313/61) | | scientific name +11572 | Bunyavirus | | equivalent name +11572 | Bunyaviruses | | equivalent name +11572 | Orthobunyavirus | | scientific name +11582 | Aino virus | | scientific name +11584 | Phlebovirus | | scientific name +11584 | Phleboviruses | | equivalent name +11617 | Arenaviridae | | scientific name +11632 | Retroviridae | | scientific name +11974 | Caliciviridae | | scientific name +12027 | Bacteriophage SP | | equivalent name +12027 | Enterobacteria phage SP | | scientific name +12027 | phage SP | | equivalent name +12030 | Bacteriophage TW19 | | equivalent name +12030 | Enterobacteria phage TW19 | | scientific name +12031 | Bacteriophage TW28 | | equivalent name +12031 | Enterobacteria phage TW28 | | scientific name +12031 | phage TW19 | | equivalent name +12031 | phage TW28 | | equivalent name +12036 | Luteovirus | | scientific name +12036 | Luteovirus subgroup I | | equivalent name +12050 | Maize chlorotic dwarf virus group | | equivalent name +12050 | Waikavirus | | scientific name +12051 | Marafivirus | | scientific name +12058 | Picornaviridae | | scientific name +12058 | Picornavirus | | synonym +12059 | Enterovirus | | scientific name +12059 | Enteroviruses | | equivalent name +12059 | Rhinovirus | | includes +12059 | Rhinoviruses | | includes +12059 | common cold viruses | | includes +12091 | Hepatovirus | | scientific name +12109 | Aphthovirus | | scientific name +12109 | Aphthoviruses | | equivalent name +12137 | Sobemovirus | | scientific name +12137 | Velvet tobacco mottle virus group | | equivalent name +12141 | Tombusvirus | | scientific name +12160 | Closterovirus | | scientific name +12163 | Carlavirus | | scientific name +12174 | Capillovirus | | scientific name +12176 | Potexvirus | | scientific name +12195 | Potyvirus | | scientific name +12234 | Tobamoviridae | | equivalent name +12234 | Tobamovirus | | scientific name +12258 | Comovirus | | scientific name +12270 | Nepovirus | | scientific name +12283 | Nodaviridae | | scientific name +12289 | Enamovirus | | scientific name +12289 | Pea enation mosaic virus group | | equivalent name +12316 | Ilarvirus | | scientific name +12429 | unassigned viruses | | equivalent name +12429 | unclassified virus | | equivalent name +12429 | unclassified viruses | | scientific name +12456 | HAstV-1 | | acronym +12456 | Human astrovirus 1 | | scientific name +12456 | Human astrovirus type 1 | | equivalent name +12456 | human astrovirus serotype 1 | | equivalent name +12471 | Solanum nodiflorum mottle virus | | scientific name +12701 | H-Ast2 | | acronym +12701 | Human astrovirus 2 | | scientific name +12701 | Human astrovirus serotype 2 H-Ast2 | | equivalent name +12701 | Human astrovirus type 2 | | equivalent name +12877 | Satellites | | synonym +12877 | unclassified satellites | | scientific name +12929 | Amazona | | scientific name +13366 | Brettanomyces | | scientific name +13366 | Brettanomyces N.H. Claussen ex Custers, 1940 | | authority +13366 | Dekkera | | synonym +13366 | Eeniella | | synonym +13502 | ATCC 48014 | ATCC 48014 | type material +13502 | Brettanomyces nanus | | scientific name +13502 | Brettanomyces nanus (M.T. Sm., Bat. Vegte & Scheffers) M.T. Sm., Boekhout, Kurtzman & O'Donnell, 1994 | | authority +13502 | CBS 1945 | CBS 1945 | type material +13502 | CCRC 21335 | CCRC 21335 | type material +13502 | CCRC:21335 | CCRC:21335 | type material +13502 | Eeniella nana | | synonym +13502 | Eeniella nana M.T. Sm., Bat. Vegte & Scheffers, 1981 | | authority +13502 | NRRL Y-17527 | NRRL Y-17527 | type material +13502 | specimen-voucher:NRRL:Y:17527 | specimen-voucher:NRRL:Y:17527 | type material +14366 | Cymbidium | | scientific name +14366 | Cymbidium Sw., 1799 | | authority +16360 | Alismatales | | scientific name +16360 | Alismatales R.Br. ex Bercht. & J.Presl, 1820 | | authority +16360 | Alismatiflorae | | in-part +16360 | Arales | | includes +16360 | Arales Lindl.,1833 | | authority +16360 | Ariflorae | | in-part +16360 | Najadales | | includes +16360 | Najadales Dumort., 1929 | | authority +16360 | Spathiflorae | | synonym +16360 | Zosterales | | includes +16360 | Zosterales J.Presl, 1846 | | authority +23461 | Mangifera | | scientific name +23461 | Mangifera L. | | authority +24966 | Dialypetalanthaceae | | includes +24966 | Dialypetalanthaceae Rizzini & Occhioni, 1948 | | authority +24966 | Rubiaceae | | scientific name +24966 | Rubiaceae Juss., 1789 | | authority +24966 | madder family | | common name +25623 | Taxaceae | | scientific name +25623 | Taxaceae Gray, 1822 | | authority +25623 | yew family | | common name +25628 | Taxus | | scientific name +25628 | Taxus L. | | authority +26473 | Buddleia | | synonym +26473 | Buddleja | | scientific name +26473 | Buddleja L., 1753 | | authority +26867 | Bougueria | | synonym +26867 | Plantago | | scientific name +26867 | Plantago L. | | authority +26867 | ribworts | | common name +27319 | Metschnikowiaceae | | scientific name +27319 | Metschnikowiaceae T. Kamienski ex Doweld, 2013 | | authority +27337 | CBS 130341 | CBS 130341 | type material +27337 | NRRL 54785 | NRRL 54785 | type material +27337 | PD322 | PD322 | type material +27337 | UC 1953893 | UC 1953893 | type material +27337 | Verticillium dahliae | | scientific name +27337 | Verticillium dahliae Klebahn, 1913 | | authority +27434 | Dermaptera | | scientific name +27434 | earwigs | earwigs | blast name +27434 | earwigs | earwigs | genbank common name +27483 | Evanioidea | | scientific name +27592 | Bovinae | | scientific name +27668 | Myotis leibii | | scientific name +27668 | Vespertilio leibii | | synonym +27668 | Vespertilio leibii Audubon & Bachman, 1842 | | authority +27668 | eastern small-footed myotis | | genbank common name +27708 | Cyprinus conchonius | | synonym +27708 | Cyprinus conchonius Hamilton, 1822 | | authority +27708 | Pethia conchonius | | scientific name +27708 | Pethia conchonius (Hamilton, 1822) | | authority +27708 | Puntius conchonius | | synonym +27708 | Puntius conchonius (Hamilton, 1822) | | authority +27708 | rosy barb | | genbank common name +27994 | Theileriidae | | scientific name +27994 | Theileriidae du Toit, 1918 | | authority +28267 | Phocine distemper virus-2 | | scientific name +28725 | Corvidae | | scientific name +28843 | Diphyllobothriidae | | scientific name +28843 | Ligulidae | | synonym +28890 | "Euryarchaeota" Woese et al. 1990 | | authority +28890 | "Methanobacteraeota" Oren et al. 2015 | | authority +28890 | "Methanobacteriota" Whitman et al. 2018 | | authority +28890 | Euryarchaeota | | synonym +28890 | Euryarchaeota Garrity and Holt 2002 | | authority +28890 | Methanobacteraeota | | synonym +28890 | Methanobacteriota | | scientific name +28890 | Methanobacteriota Garrity and Holt 2023 | | authority +28890 | euryarchaeotes | euryarchaeotes | blast name +28890 | euryarchaeotes | euryarchaeotes | genbank common name +29961 | Parastacoidea | | scientific name +29962 | Grapsidoidea | | synonym +29962 | Grapsoidea | | scientific name +30092 | Psyllidae | | scientific name +30093 | Trioza | | scientific name +30093 | Trioza Foerster, 1848 | | authority +30102 | Cicadellidae | | scientific name +30102 | Jassidae | | synonym +30102 | leafhoppers | | genbank common name +30367 | Ambystomatoidea | | synonym +30367 | Salamandroidea | | scientific name +30388 | Chaja torquata | | synonym +30388 | Chaja torquata Oken, 1816 | | authority +30388 | Chauna torquata | | scientific name +30388 | southern screamer | | genbank common name +30449 | Procellariiformes | | scientific name +30449 | petrels and albatrosses | | genbank common name +30560 | Microchiroptera | | synonym +30560 | Vespertilioniformes | | synonym +30560 | Yangochiroptera | | scientific name +30725 | Catostomoidea | | synonym +30725 | Cobitoidei | | scientific name +30727 | Cyprinoidea | | synonym +30727 | Cyprinoidei | | scientific name +30806 | Channichthyidae | | scientific name +30806 | crocodile icefishes | | genbank common name +30806 | white-blooded fish | | common name +30871 | Serranidae | | scientific name +30871 | sea basses | | genbank common name +30942 | Pleuronectoidei | | scientific name +30942 | Soleoidei | | synonym +31271 | Plasmodium chabaudi chabaudi | | scientific name +31370 | Batrachospermales | | scientific name +31371 | Batrachospermaceae | | scientific name +31371 | Brachtospermaceae | | synonym +31468 | Gracilariales | | scientific name +31469 | Gracilariaceae | | scientific name +31612 | Adelaide River virus | | scientific name +31870 | CBS 130836 | CBS 130836 | type material +31870 | Colletotrichopsis graminicola | | synonym +31870 | Colletotrichum graminicola | | scientific name +31870 | Colletotrichum graminicola (Ces.) G.W. Wilson, 1914 | | authority +31870 | Dicladium graminicola | | synonym +31870 | Dicladium graminicola Ces., 1852 | | authority +31870 | Dicladium graminicolum | | synonym +31870 | Glomerella graminicola | | synonym +31870 | Glomerella graminicola D.J. Politis, 1975 | | authority +31870 | M1.001 | M1.001 | type material +31870 | Steirochaete graminicola | | synonym +32443 | Teleostei | | scientific name +32443 | teleost fishes | | genbank common name +32519 | Ostariophysi | | scientific name +32523 | Tetrapoda | | scientific name +32523 | tetrapods | | genbank common name +32524 | Amniota | | scientific name +32524 | amniotes | | genbank common name +32525 | Theria | Theria | scientific name +32525 | Theria Parker & Haswell, 1897 | | authority +32561 | Diapsida | | synonym +32561 | Sauria | | scientific name +32561 | diapsids | | genbank common name +32613 | Ephemerovirus | | scientific name +32620 | Iris severe mosaic virus | | scientific name +33090 | Chlorobionta | | synonym +33090 | Chlorobionta Jeffrey, 1982 | | authority +33090 | Chlorophyta/Embryophyta group | | equivalent name +33090 | Chloroplastida | | synonym +33090 | Chloroplastida Adl et al. 2005 | | authority +33090 | Viridiplantae | | scientific name +33090 | Viridiplantae Cavalier-Smith, 1981 | | authority +33090 | chlorophyte/embryophyte group | | equivalent name +33090 | green plants | green plants | blast name +33090 | green plants | green plants | common name +33154 | Fungi/Metazoa group | | synonym +33154 | Opisthokonta | | scientific name +33154 | Opisthokonta Cavalier-Smith 1987 | | authority +33154 | opisthokonts | | synonym +33183 | Arachnomycetales | | synonym +33183 | Arachnomycetales Gibas, Sigler & Currah, 2002 | | authority +33183 | Ascosphaerales | | synonym +33183 | Gymnoascales | | synonym +33183 | Onygenales | | scientific name +33183 | Onygenales Cif. ex Benny & Kimbr., 1980 | | authority +33184 | Amauroascaceae | | synonym +33184 | Amauroascaceae Arx, 1987 | | authority +33184 | Onygenaceae | | scientific name +33184 | Onygenaceae E. Fisch., 1898 | | authority +33208 | Animalia | | synonym +33208 | Metazoa | | scientific name +33208 | animals | animals | blast name +33208 | animals | animals | genbank common name +33208 | metazoans | | common name +33208 | multicellular animals | | common name +33213 | Bilateria | | scientific name +33256 | Ascaridoidea | | scientific name +33317 | Protostomia | | scientific name +33339 | Palaeoptera | | scientific name +33340 | Neoptera | | scientific name +33341 | Orthopteroidea | | synonym +33341 | Polyneoptera | | scientific name +33342 | Hemipteroidea | | synonym +33342 | Paraneoptera | | scientific name +33342 | hemipteroid assemblage | | includes +33365 | Cicadomorpha | | scientific name +33365 | Clypeorrhyncha | | synonym +33368 | Cicadelloidea | | synonym +33368 | Membracoidea | | scientific name +33372 | Deltocephalinae | | scientific name +33372 | Deltocephalinae Dallas, 1870 | | authority +33373 | Sternorrhyncha | | scientific name +33375 | Psylliformes | | synonym +33375 | Psylloidea | | scientific name +33375 | Psyllomorpha | | synonym +33375 | jumping plant lice | | common name +33375 | psyllids | psyllids | blast name +33375 | psyllids | psyllids | genbank common name +33392 | Endopterygota | | scientific name +33392 | Holometabola | | synonym +33415 | Nymphalidae | | scientific name +33415 | Satyridae | | includes +33415 | brush-footed butterflies | | common name +33415 | brushfoots | | genbank common name +33511 | Deuterostomia | | scientific name +33511 | deuterostomes | | common name +33554 | Carnivora | | scientific name +33554 | carnivores | carnivores | blast name +33554 | carnivores | carnivores | genbank common name +33599 | Coccyzidae | | scientific name +33600 | Piaya | | scientific name +33601 | Cuculus cayanus | | synonym +33601 | Cuculus cayanus Linnaeus, 1766 | | authority +33601 | Piaya cayana | | scientific name +33601 | squirrel cuckoo | | genbank common name +33630 | Alveolata | | scientific name +33630 | alveolates | alveolates | blast name +33630 | alveolates | alveolates | genbank common name +33634 | Chromophyta | Chromophyta | in-part +33634 | Heterokonta | | synonym +33634 | Stramenopiles | | scientific name +33634 | Stramenopiles Patterson 1989, emend. Adl et al. 2005 | | authority +33634 | Straminipila | | synonym +33634 | heterokonts | heterokonts | blast name +33634 | heterokonts | heterokonts | genbank common name +34111 | Monoraphidium | | scientific name +34111 | Monoraphidium Komark-Legn., 1969 | | authority +34145 | Closterium | | scientific name +34145 | Closterium Nitzsch ex Ralfs, 1848 | | authority +34384 | Arthrodermataceae | | scientific name +34384 | Arthrodermataceae Locq. ex Currah, 1985 | | authority +34384 | Arthrodermataceae anamorphs | | synonym +34384 | anamorphic Arthrodermataceae | | synonym +34384 | dermatophytes | | genbank common name +34384 | mitosporic Arthrodermataceae | | includes +34392 | Microsporum | | scientific name +34392 | Microsporum Gruby, 1843 | | authority +34397 | Clavicipitaceae | | scientific name +34397 | anamorphic Clavicipitaceae | | includes +34397 | mitosporic Clavicipitaceae | | includes +34448 | Marasmius | | scientific name +34448 | Marasmius Fr., 1835 | | authority +34667 | Cerambycidae | | scientific name +34667 | long-horned beetles | | genbank common name +34735 | Apoidea | | scientific name +35069 | Crinoidea | | scientific name +35069 | crinoids | crinoids | blast name +35069 | crinoids | crinoids | genbank common name +35070 | Articulata | Articulata | scientific name +35249 | unassigned Gammaherpesvirinae | | equivalent name +35249 | unclassified Gammaherpesvirinae | | scientific name +35278 | ssRNA positive-strand viruses | | equivalent name +35278 | ssRNA positive-strand viruses, no DNA stage | | equivalent name +35278 | unclassified ssRNA positive-strand viruses | | scientific name +35278 | unclassified ssRNA positive-strand viruses, no DNA stage | | equivalent name +35300 | HAstV-4 | | acronym +35300 | Human astrovirus 4 | | scientific name +35300 | Human astrovirus type 4 | | equivalent name +35303 | unassigned Rhabdoviridae | | synonym +35303 | unclassified Dimarhabdovirus supergroup | | includes +35303 | unclassified Rhabdoviridae | | scientific name +35323 | Thogoto-like viruses | | equivalent name +35323 | Thogotovirus | | scientific name +35325 | dsRNA nonenveloped viruses | | equivalent name +35325 | dsRNA viruses | | scientific name +35342 | ssDNA nonenveloped viruses | | equivalent name +35342 | ssDNA viruses | | equivalent name +35342 | unclassified ssDNA nonenveloped viruses | | equivalent name +35342 | unclassified ssDNA viruses | | scientific name +35466 | Selenastraceae | | scientific name +35466 | Selenastraceae Blackman & Tansley, 1903 | | authority +35491 | DO clade | | synonym +35491 | Sphaeropleales | | scientific name +35491 | Sphaeropleales Luerssen, 1877 | | authority +35493 | Streptophyta | | scientific name +35493 | Streptophyta Bremer, 1985 | | authority +35500 | Pecora | | scientific name +35627 | Stylosanthes | | scientific name +35627 | Stylosanthes Sw., 1788 | | authority +35634 | Ischnocera | | scientific name +35634 | Ischnocera Kellogg, 1896 | | authority +35634 | Mallophaga | Mallophaga | in-part +35634 | chewing lice | chewing lice | genbank common name +35709 | Chusquea | | scientific name +35709 | Chusquea Kunth, 1816 | | authority +35718 | Chaetomiaceae | | scientific name +35718 | Chaetomiaceae G. Winter, 1885 | | authority +35740 | HAstV-3 | | acronym +35740 | Human astrovirus 3 | | scientific name +35740 | Human astrovirus type 3 | | equivalent name +35741 | HAstV-5 | | acronym +35741 | Human astrovirus 5 | | scientific name +35741 | Human astrovirus type 5 | | equivalent name +35869 | Zygnema circumcarinatum | | scientific name +35869 | Zygnema circumcarinatum Czurda | | authority +35869 | Zygnemopsis circumcarinata | | synonym +36050 | Fusarium poae | | scientific name +36050 | Fusarium poae (Peck) Wollenw., 1913 | | authority +36050 | NRRL 26941 | NRRL 26941 | type material +36050 | Sporotrichum poae | | synonym +36050 | Sporotrichum poae Peck, 1904 | | authority +36291 | Muscicapidae | | scientific name +36291 | Old World flycatchers | | genbank common name +37130 | HAstV-6 | | acronym +37130 | Human astrovirus 6 | | scientific name +37130 | Human astrovirus type 6 | | equivalent name +37567 | Ditrysia | | scientific name +37569 | Bombycoidea | | scientific name +37569 | Sphingoidea | | synonym +37569 | hawk-moths | | genbank common name +37570 | Noctuoidea | | scientific name +37572 | Papilionoidea | | scientific name +37572 | butterflies | butterflies | blast name +37572 | butterflies | butterflies | genbank common name +37573 | Pyraloidea | | scientific name +37660 | Caribbean stylo | | genbank common name +37660 | Hedysarum hamatum | | synonym +37660 | Hedysarum hamatum L., 1759 | | authority +37660 | Stylosanthes hamata | | scientific name +37660 | Stylosanthes hamata (L.) Taub., 1890 | | authority +37660 | cheesytoes | | common name +37754 | Human papillomavirus unidentified type (ICPX1) | | scientific name +37755 | Human papillomavirus unidentified type (RTRX1) | | scientific name +37756 | Human papillomavirus unidentified type (RTRX2) | | scientific name +37757 | Human papillomavirus unidentified type (RTRX3) | | scientific name +37758 | Human papillomavirus unidentified type (RTRX4) | | scientific name +37759 | Human papillomavirus unidentified type (RTRX5) | | scientific name +37760 | Human papillomavirus unidentified type (RTRX6) | | scientific name +37844 | Monopisthocotylea | | scientific name +37850 | Parastacidae | | scientific name +37945 | Monogenea | | scientific name +37960 | unassigned Partitiviridae | | equivalent name +37960 | unclassified Alphacryptovirus | | equivalent name +37960 | unclassified Partitiviridae | | scientific name +37960 | unclassified Partitivirus | | equivalent name +38033 | CBS 160.62 | CBS 160.62 | type material +38033 | Chaetomium globosum | | scientific name +38033 | Chaetomium globosum Kunze ex Fr. 1829 | | authority +38033 | Chaetomium globosum Kunze ex Fries, 1829 | | authority +38033 | Chaetomium rectum | | synonym +38033 | Chaetomium rectum Sergeeva 1961 | | authority +38033 | Chaetomium sp. MUT 4942 | | includes +38124 | Triozidae | | scientific name +38144 | unclassified Flaviviridae | | scientific name +38605 | Didelphimorphia | | scientific name +38820 | Cyperales | | includes +38820 | Poales | | scientific name +38820 | Typhales | | includes +38950 | HAstV-7 | | acronym +38950 | Human astrovirus 7 | | scientific name +38950 | Human astrovirus type 7 | | equivalent name +39249 | Scrophularia | | scientific name +39249 | Scrophularia L., 1753 | | authority +39249 | figworts | | genbank common name +39724 | Circoviridae | | scientific name +39725 | Circovirus | | scientific name +39729 | Potyviridae | | scientific name +39731 | Bymovirus | | scientific name +39733 | Astroviridae | | scientific name +39734 | Umbravirus | | scientific name +39738 | Tombusviridae | | scientific name +39740 | Bromoviridae | | scientific name +39750 | Aquabirnavirus | | scientific name +39756 | unclassified Totiviridae | | scientific name +39760 | Idaeovirus | | scientific name +39780 | unclassified dsRNA viruses | | scientific name +39804 | Allolevivirus subgroup IV | | equivalent name +39804 | Bacteriophage FI | | equivalent name +39804 | Enterobacteria phage FI | | equivalent name +39804 | Enterobacteria phage isolate FI | | equivalent name +39804 | Escherichia virus FI | | equivalent name +39804 | Qubevirus faecium | | scientific name +39804 | phage FI | | equivalent name +39804 | serumgroup IV | | equivalent name +39829 | Ocypodoidea | | scientific name +39831 | "Bacterium rhinoscleromatis" (Trevisan 1887) Migula 1900 | | authority +39831 | ATCC 13884 | ATCC 13884 | type material +39831 | Bacterium rhinoscleromatis | | synonym +39831 | CCUG 417 | CCUG 417 | type material +39831 | CIP 52.210 | CIP 52.210 | type material +39831 | DSM 16231 | DSM 16231 | type material +39831 | JCM 1664 | JCM 1664 | type material +39831 | Klebsiella pneumoniae subsp. rhinoscleromatis | | scientific name +39831 | Klebsiella pneumoniae subsp. rhinoscleromatis (Trevisan 1887) Orskov 1984 | | authority +39831 | Klebsiella rhinoscleromatis | | synonym +39831 | Klebsiella rhinoscleromatis Trevisan 1887 (Approved Lists 1980) | | authority +39831 | LMG 3184 | LMG 3184 | type material +39831 | LMG:3184 | LMG:3184 | type material +39831 | NCTC 5046 | NCTC 5046 | type material +40065 | Chenuda complex | | equivalent name +40065 | Chenuda virus | | scientific name +40067 | Wad Medani complex | | equivalent name +40067 | Wad Medani virus | | scientific name +40068 | unclassified Orbivirus | | scientific name +40092 | Hesperioidea | | scientific name +40093 | Hesperiidae | | scientific name +40093 | skippers | | genbank common name +40119 | Parvovirinae | | scientific name +40120 | Densovirinae | | scientific name +40122 | Iteradensovirus | | scientific name +40122 | Iteravirus | | equivalent name +40272 | Roseolovirus | | scientific name +40562 | Strophariaceae | | scientific name +40562 | Strophariaceae Singer & A.H. Sm., 1946 | | authority +40588 | Dipterocarpaceae | | scientific name +40588 | Dipterocarpaceae Blume, 1825 | | authority +40588 | meranti family | | common name +40674 | Mammalia | | scientific name +40674 | mammals | mammals | blast name +40674 | mammals | mammals | genbank common name +40948 | Angelica | | scientific name +40948 | Angelica L., 1753 | | authority +41071 | Adephaga | | scientific name +41073 | Carabidae | | scientific name +41073 | ground beetles | | genbank common name +41084 | Polyphaga | Polyphaga | scientific name +41088 | Chrysomeliformia | Chrysomeliformia | includes +41088 | Cucujiformia | | scientific name +41154 | Prioninae | | scientific name +41155 | Lepturinae | | scientific name +41191 | Glossata | | scientific name +41196 | Neolepidoptera | | scientific name +41197 | Heteroneura | | scientific name +41479 | Aster | | scientific name +41479 | Aster L., 1753 | | authority +41549 | Cirsium | | scientific name +41549 | Cirsium Mill., 1754 | | authority +41665 | Neopterygi | | synonym +41665 | Neopterygii | | scientific name +41666 | Batrachia | | scientific name +41705 | Protacanthopterygii | | scientific name +41768 | Berberidales | | includes +41768 | Berberidineae | | includes +41768 | Ranunculales | | scientific name +41768 | Ranunculineae | | includes +41773 | Berberidaceae | | scientific name +41773 | Berberidaceae Juss., 1789 | | authority +41773 | Podophyllaceae | | includes +41773 | barberry family | | common name +41827 | Culicoidea | | scientific name +41937 | Rutanae | | in-part +41937 | Sapindales | | scientific name +41938 | Malvales | | scientific name +41938 | Malvanae | | in-part +43358 | HAstV-8 | | acronym +43358 | Human astrovirus 8 | | scientific name +43358 | Human astrovirus type 8 | | equivalent name +43464 | Circaetus | | scientific name +43786 | Culicomorpha | | scientific name +43817 | Culicinae | | scientific name +43951 | Zygnema | | scientific name +43951 | Zygnema C.Agardh, 1817 | | authority +44560 | AYVV | | acronym +44560 | Ageratum yellow vein virus | | scientific name +45234 | Cordyceps | | scientific name +45234 | Cordyceps Fr., 1833 | | authority +45234 | Parahevansia | | synonym +45234 | Parahevansia Mongkolsamrit & Noisripoom, 2022 | | authority +45357 | ATCC 22991 | ATCC 22991 | type material +45357 | CBS 5149 | CBS 5149 | type material +45357 | Candida haemuli (Uden & Kolip.) S.A. Mey. & Yarrow 1978 | | synonym +45357 | Candida haemulonii | | synonym +45357 | Candida haemulonii type II | | includes +45357 | Candida haemulonis | | synonym +45357 | Candidozyma haemuli | | scientific name +45357 | Candidozyma haemuli (Uden & Kolip.) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai, 2024 | | authority +45357 | DBVPG 6958 | DBVPG 6958 | type material +45357 | IFO 10001 | IFO 10001 | type material +45357 | IGC 3025 | IGC 3025 | type material +45357 | JCM 3762 | JCM 3762 | type material +45357 | NRRL Y-6693 | NRRL Y-6693 | type material +45357 | Torulopsis haemuli Uden & Kolip., 1962 | | synonym +45357 | Torulopsis haemuloni | | synonym +45357 | specimen-voucher:NRRL:Y:6693 | specimen-voucher:NRRL:Y:6693 | type material +45607 | AJ 4995 | AJ 4995 | type material +45607 | ATCC 60130 | ATCC 60130 | type material +45607 | CBS 6739 | CBS 6739 | type material +45607 | CCRC 22618 | CCRC 22618 | type material +45607 | CCRC:22618 | CCRC:22618 | type material +45607 | Candida sorbophila | | synonym +45607 | IFO 1583 | IFO 1583 | type material +45607 | JCM 1514 | JCM 1514 | type material +45607 | NRRL Y-7921 | NRRL Y-7921 | type material +45607 | Torulopsis sorbophila | | synonym +45607 | Torulopsis sorbophila Nakase, 1975 | | authority +45607 | Wickerhamiella sorbophila | | scientific name +45607 | Wickerhamiella sorbophila (Nakase) C. Vega & Lachance, 2017 | | authority +45607 | specimen-voucher:NRRL:Y:7921 | specimen-voucher:NRRL:Y:7921 | type material +45787 | Wickerhamiella | | scientific name +45787 | Wickerhamiella Van der Walt & Liebenberg, 1973 | | authority +45950 | Dreissenidae | | scientific name +45951 | Dreissena | | scientific name +46108 | Suaeda | | scientific name +46108 | Suaeda Forssk. ex J.F.Gmel., 1776 | | authority +46108 | sea-blites | | common name +46108 | seepweeds | | genbank common name +46366 | Bupleurum | | scientific name +46366 | Bupleurum L. | | authority +46569 | Termitidae | | scientific name +46569 | desert termites | | genbank common name +46569 | higher termites | | common name +46619 | Sweet potato G virus | | equivalent name +46619 | Sweet potato virus G | | scientific name +47455 | Pariana | | scientific name +47455 | Pariana Aubl., 1775 | | authority +47456 | Pariana radiciflora | | scientific name +47456 | Pariana radiciflora Sagot ex Doell., 1877 | | authority +47520 | Palaeoheterodonta | | scientific name +47521 | Unionida | | scientific name +47521 | Unionoida | | synonym +47522 | Unionacea | | synonym +47522 | Unionoidea | | scientific name +47523 | Ambleminae | | scientific name +47523 | Pleurobeminae | | includes +47523 | Quadrulinae | | includes +47524 | Amblema | | scientific name +47526 | Unionidae | | scientific name +47567 | Contracaecum | | scientific name +49188 | Aconitum | | scientific name +49188 | Aconitum Finet & Gagnep., 1904 | | authority +49669 | Paris | | scientific name +49669 | Paris L., 1753 | | authority +49817 | Erythrina crista-galli | | scientific name +49817 | Erythrina crista-galli L., 1767 | | authority +49817 | ceibo | | common name +49817 | cockspur coraltree | | genbank common name +49817 | cry-baby tree | | common name +50292 | African green monkey cytomegalovirus | | equivalent name +50292 | CeHV-5 | | acronym +50292 | Cercopithecine betaherpesvirus 5 | | scientific name +50292 | Cercopithecine herpesvirus 5 | | equivalent name +50292 | Simian cytomegalovirus (strain Colburn) | | equivalent name +50362 | Melanthiaceae | | scientific name +50362 | Melanthiaceae Batsch ex Borkh., 1797 | | authority +50362 | Trilliaceae | | synonym +50362 | trillium family | | common name +50435 | Hemerobiidae | | scientific name +50435 | brown lacewings | | genbank common name +50435 | trashbugs | | common name +50488 | Zygoptera | | scientific name +50488 | damselflies | damselflies | blast name +50488 | damselflies | damselflies | genbank common name +50489 | Calopterygidae | | scientific name +50489 | broad-winged damselflies | | genbank common name +50515 | Dytiscidae | | scientific name +50515 | predacious diving beetles | | genbank common name +50557 | Insecta | | scientific name +50557 | insects | insects | blast name +50557 | insects | insects | genbank common name +50557 | true insects | | common name +50713 | Cocal virus | | scientific name +51909 | Pyrrhura | | scientific name +52123 | Oceanodroma | | scientific name +52360 | Amblema perplicata | | scientific name +52360 | Amblema plicata | | synonym +52360 | Unio plicata | | synonym +52360 | Unio plicata Say, 1817 | | authority +52974 | Bartramiaceae | | scientific name +52974 | Bartramiaceae Schwaegr., 1830 | | authority +52975 | Bartramia | Bartramia | scientific name +52975 | Bartramia Hedw., 1801 | | authority +52976 | Bartramia pomiformis | | scientific name +52976 | Bartramia pomiformis Hedw., 1801 | | authority +53017 | Batken virus | | scientific name +53058 | Chiloschista | | scientific name +53058 | Chiloschista Lindl., 1832 | | authority +53124 | Phragmipedilum | | synonym +53124 | Phragmipedium | | scientific name +53124 | Phragmipedium Rolfe, 1896 | | authority +53300 | Macrophthalmus | | scientific name +53541 | Stegomyia | | scientific name +54049 | Stercorariidae | | scientific name +54057 | Catharacta | | synonym +54057 | Stercorarius | | scientific name +54057 | Stercorarius Brisson, 1760 | | authority +54059 | Larus parasiticus | | synonym +54059 | Larus parasiticus Linnaeus, 1758 | | authority +54059 | Stercorarius parasiticus | | scientific name +54354 | Aramidae | | scientific name +54354 | limpkins | | genbank common name +54355 | Aramus | | scientific name +54356 | Aramus guarauna | | scientific name +54356 | Aramus guarauna (Linnaeus, 1766) | | authority +54356 | Scolopax guarauna | | synonym +54356 | Scolopax guarauna Linnaeus, 1766 | | authority +54356 | limpkin | | genbank common name +54357 | Psophiidae | | scientific name +54357 | trumpeters | | genbank common name +54358 | Psophia | | scientific name +54359 | Psophia crepitans | | scientific name +54359 | Psophia crepitans Linnaeus, 1758 | | authority +54359 | common trumpeter | | genbank common name +54757 | Plasmodium vinckei subsp. vinckei | | synonym +54757 | Plasmodium vinckei vinckei | | scientific name +55136 | Myliobatinae | | scientific name +55136 | eagle rays | | genbank common name +55193 | Malassezia | | scientific name +55193 | Malassezia Baill., 1889 | | authority +55267 | Maricola | | scientific name +55867 | Scolytidae | | synonym +55867 | Scolytinae | | scientific name +55867 | ambrosia beetles | ambrosia beetles | common name +55867 | bark beetles | | genbank common name +56259 | Accipitridae | | scientific name +56301 | Musophagiformes | | scientific name +56301 | turacos | | genbank common name +56302 | Musophagidae | | scientific name +56308 | Trogoniformes | | scientific name +56308 | trogons and quetzals | | genbank common name +56309 | Trogonidae | | scientific name +56310 | Trogon | | scientific name +56311 | Trogon melanurus | | scientific name +56311 | Trogon melanurus Swainson, 1838 | | authority +56311 | black-tailed trogon | | genbank common name +56342 | Herpetotheres | | scientific name +56343 | Falco cachinnans | | synonym +56343 | Falco cachinnans Linnaeus, 1758 | | authority +56343 | Herpetotheres cachinnans | | scientific name +56646 | CBS 458.93 | CBS 458.93 | type material +56646 | Fusarium venenatum | | scientific name +56646 | Fusarium venenatum Nirenberg, 1995 | | authority +56646 | Fusarium venetum | | synonym +56646 | ICMP:20649 | ICMP:20649 | type material +56785 | Nucifraga | | scientific name +56866 | Cucumis acutangulus | | synonym +56866 | Cucumis acutangulus L., 1753 | | authority +56866 | Cucurbita acutangula | | synonym +56866 | Cucurbita acutangula (L.) Blume, 1826 | | authority +56866 | Luffa acutangula | | scientific name +56866 | Luffa acutangula (L.) Roxb., 1832 | | authority +56866 | angled luffa | | genbank common name +56866 | ribbed gourd | | common name +56866 | ribbed luffa | | common name +56866 | ridged gourd | | common name +56866 | silky gourd | | common name +56866 | singkwa towel gourd | | common name +57379 | Bucerotiformes | | scientific name +57379 | Upupiformes | | includes +57379 | hoopoes and others | | common name +57379 | hornbills | | genbank common name +57382 | Centropidae | | scientific name +57383 | Cerylidae | | scientific name +57401 | Centropus | | scientific name +57405 | Chloroceryle | | scientific name +58019 | Coniferophyta | | equivalent name +58019 | Coniferopsida | | synonym +58019 | Pinopsida | | scientific name +58019 | conifers | | common name +58023 | Tracheophyta | | scientific name +58023 | Tracheophyta Sinnott ex Cavalier-Smith, 1998 | | authority +58023 | vascular plants | vascular plants | blast name +58023 | vascular plants | vascular plants | common name +58024 | Spermatophyta | | scientific name +58024 | seed plants | seed plants | blast name +58024 | seed plants | seed plants | common name +58627 | ATCC 20278 | ATCC 20278 | type material +58627 | BCRC 21710 | BCRC 21710 | type material +58627 | CBS 789 | CBS 789 | type material +58627 | CECT 11370 | CECT 11370 | type material +58627 | CECT 11370T | CECT 11370T | type material +58627 | Debaryomyces fabryi | | scientific name +58627 | Debaryomyces fabryi M. Ota, 1924 | | authority +58627 | Debaryomyces fabryi M.Ota, 1924 | | authority +58627 | Debaryomyces hansenii var. fabryi | | synonym +58627 | Debaryomyces hansenii var. fabryi (M.Ota) Nakase & M. Suzuki 1985 | | authority +58627 | IFO 0015 | IFO 0015 | type material +58627 | JCM 2104 | JCM 2104 | type material +58627 | KCTC 7603 | KCTC 7603 | type material +58627 | NBRC 0015 | NBRC 0015 | type material +58627 | NRRL Y-17914 | NRRL Y-17914 | type material +58627 | Y-17914 | Y-17914 | type material +58627 | type strain: CBS 789 | type strain: CBS 789 | type material +59171 | Patrinia | | scientific name +59171 | Patrinia Juss., 1807 | | authority +59172 | Patrinia rupestris | | scientific name +59172 | Patrinia rupestris Dufr., 1811 | | authority +59500 | Rice necrosis mosaic virus | | scientific name +60456 | Iris yellow spot virus | | scientific name +60807 | Scaritini | | scientific name +60808 | Scarites | | scientific name +60809 | Scarites subterraneus | | scientific name +60809 | Scarites subterraneus Fabricius, 1775 | | authority +62020 | Mnais | | scientific name +62020 | Mnais Selys, 1853 | | authority +62110 | Dahlstedtia | | scientific name +62110 | Dahlstedtia Malme, 1905 | | authority +62784 | Tettigoniidae | | scientific name +62784 | bush-crickets | | common name +62784 | bushcrickets | | common name +62784 | katydids | | genbank common name +62784 | long-horned grasshoppers | | common name +63225 | Lepus townsendii | | scientific name +63225 | Lepus townsendii Bachman, 1839 | | authority +63225 | white-tailed jackrabbit | | genbank common name +63405 | Arthroderma otae | | synonym +63405 | Arthroderma otae (A. Haseg. & Usui) McGinnis, Weitzman, A.A. Padhye & Ajello, 1986 | | synonym +63405 | CBS 496.86 | CBS 496.86 | type material +63405 | Microsporum canis | | scientific name +63405 | Microsporum canis E. Bodin ex Gueg., 1902 | | authority +63405 | Nannizzia otae | | synonym +63405 | Nannizzia otae A. Haseg. & Usui 1974 | | authority +64021 | Cherry small circular viroid-like RNA | | scientific name +64579 | Vatica | | scientific name +64579 | Vatica L. | | authority +65009 | Dipterocarpoideae | | scientific name +65068 | PRMV | | acronym +65068 | Peach rosette mosaic virus | | scientific name +65068 | peach rosette mosaic Nepovirus | | equivalent name +65386 | Anomalodesmata | | scientific name +65386 | Pholadomyoida | | synonym +66236 | Philopteridae | | scientific name +66236 | bird lice | | genbank common name +67753 | Crinivirus | | scientific name +67762 | TbLCV | | acronym +67762 | Tobacco leaf curl virus | | scientific name +67762 | tobacco leaf curl geminivirus | | equivalent name +67762 | tobacco leafcurl virus | | equivalent name +68416 | Woolly monkey hepatitis B virus | | scientific name +69720 | Zantedeschia | | scientific name +69720 | Zantedeschia Spreng., 1826 | | authority +69721 | Calla aethiopica | | synonym +69721 | Calla aethiopica L., 1753 | | authority +69721 | Zantedeschia aethiopica | | scientific name +69721 | Zantedeschia aethiopica (L.) Spreng., 1826 | | authority +69721 | arum-lily | | common name +69721 | calla lily | | genbank common name +69721 | pig-lily | | common name +69973 | Closteroviridae | | scientific name +70085 | Sicyopterus | | scientific name +70170 | Green turtle herpesvirus | | scientific name +70439 | Chaenodraco | | scientific name +70440 | Chaenodraco wilsoni | | scientific name +70440 | Chaenodraco wilsoni Regan, 1914 | | authority +70440 | spiny icefish | | common name +70564 | Hawaiian green turtle herpesvirus | | scientific name +70778 | Acropora nasuta | | scientific name +70778 | Madrepora nasuta | | synonym +70778 | Madrepora nasuta Dana, 1846 | | authority +70893 | Calopterygoidea | | scientific name +70905 | Tettigonioidea | | scientific name +70987 | Apinae | | scientific name +70987 | honey bees | | genbank common name +71112 | Lontra | | scientific name +71112 | Lontra Gray, 1843 | | authority +71239 | Cucurbitales | | scientific name +71239 | Cucurbitales Juss. ex Bercht. & J.Presl, 1820 | | authority +71240 | Dicotyledoneae | | in-part +71240 | dicots | | in-part +71240 | dicotyledons | | in-part +71240 | eudicots | eudicots | blast name +71240 | eudicots | eudicots | common name +71240 | eudicotyledons | | scientific name +71274 | Asteridae | | equivalent name +71274 | asterids | | scientific name +71275 | Rosidae | | in-part +71275 | rosids | | scientific name +71528 | Chrysomeliformia | Chrysomeliformia | in-part +71528 | Chrysomeloidea | | scientific name +71528 | Phytophaga | | in-part +71529 | Chrysomeliformia | Chrysomeliformia | in-part +71529 | Curculionoidea | | scientific name +71529 | Phytophyaga | | in-part +71950 | Psilocybe | | scientific name +71950 | Psilocybe (Fr.) P. Kumm., 1871 | | authority +72018 | Sphaeroforma | | scientific name +72019 | Sphaeroforma arctica | | scientific name +72019 | Sphaerosoma arcticum | | synonym +72019 | Sphaerosoma arcticus | | synonym +72025 | Fabales | | scientific name +72041 | Eumalacostraca | | scientific name +72407 | ATCC 13883 | ATCC 13883 | type material +72407 | CCUG 225 | CCUG 225 | type material +72407 | CDC 298-53 | CDC 298-53 | type material +72407 | CIP 82.91 | CIP 82.91 | type material +72407 | Citrobacter sp. 43UCKPC_BLUE2PLATE | | includes +72407 | Citrobacter sp. 43UCKPC_BLUE4LB | | includes +72407 | DSM 30104 | DSM 30104 | type material +72407 | Enterobacteriaceae bacterium 291_EBAC | | includes +72407 | HAMBI 450 | HAMBI 450 | type material +72407 | IAM 14200 | IAM 14200 | type material +72407 | IFO 14940 | IFO 14940 | type material +72407 | JCM 1662 | JCM 1662 | type material +72407 | Klebsiella pneumoniae subsp. pneumoniae | | scientific name +72407 | Klebsiella pneumoniae subsp. pneumoniae (Schroeter 1886) Trevisan 1887 | | authority +72407 | Klebsiella sp. CCUG 225 | | includes +72407 | Klebsiella sp. NCTC 8172 | | includes +72407 | Klebsiella sp. VTT E-95647 | | includes +72407 | Klebsiella sp. VTT E-96687 | | includes +72407 | LMG 2095 | LMG 2095 | type material +72407 | LMG:2095 | LMG:2095 | type material +72407 | NBRC 14940 | NBRC 14940 | type material +72407 | NCTC 9633 | NCTC 9633 | type material +72876 | Varunidae | | scientific name +73275 | Helianthus argophyllus | | scientific name +73275 | Helianthus argophyllus Torr. & A.Gray, 1842 | | authority +73496 | Asparagales | | scientific name +73496 | Asparagales Link, 1829 | | authority +73496 | Liliales/Asparagales group | Liliales/Asparagales group | in-part +73496 | Liliiflorae | Liliiflorae | in-part +73501 | Clavaria militaris | | synonym +73501 | Clavaria militaris L., 1753 | | authority +73501 | Cordyceps militaris | | scientific name +73501 | Cordyceps militaris (L.) Fr., 1818 | | authority +74132 | Symphysodon | Symphysodon | scientific name +74133 | Symphysodon aequifasciata | | scientific name +74133 | Symphysodon aequifasciata Pellegrin, 1904 | | authority +74133 | Symphysodon aequifasciatus | | synonym +74133 | blue discus | | genbank common name +74133 | green discus | | common name +74320 | BusuNPV | | acronym +74320 | Buzura suppressaria NPV | | equivalent name +74320 | Buzura suppressaria nuclear polyhedrosis virus | | synonym +74320 | Buzura suppressaria nucleocapsid nuclear polyhedrosis virus | | equivalent name +74320 | Buzura suppressaria nucleopolyhedrosisvirus | | equivalent name +74320 | Buzura suppressaria nucleopolyhedrovirus | | scientific name +74320 | Buzura suppressaria single nucleocapsid nuclear polyhedrosis virus | | equivalent name +74649 | China rose | | common name +74649 | Rosa chinensis | | scientific name +74649 | Rosa chinensis Jacq., 1768 | | authority +74649 | Rosa indica auct., non L. | | synonym +74694 | Veronicastrum | | scientific name +74694 | Veronicastrum Heist. ex Fabr., 1759 | | authority +75725 | Enterobacteria phage NL95 | | scientific name +75725 | bacteriophage NL95 | | equivalent name +75739 | Eucoccidiida | | synonym +75739 | Eucoccidiorida | | scientific name +75747 | FUPO-1 | | acronym +75747 | Fusarium poae virus 1 | | scientific name +76717 | Lontra canadensis | | scientific name +76717 | Lontra canadensis Schreber, 1777 | | authority +76717 | Lutra canadensis | | synonym +76717 | Northern American river otter | | genbank common name +76717 | river otter | | common name +76775 | ATCC 96801 | ATCC 96801 | type material +76775 | CBS 7877 | CBS 7877 | type material +76775 | Malassezia restricta | | scientific name +76775 | Malassezia restricta E. Gueho, J. Guillot & Midgley, 1996 | | authority +76803 | Arteriviridae | | scientific name +76804 | Nidovirales | | scientific name +77519 | Plasmodium gonderi | | scientific name +78060 | Alectoriaceae | | synonym +78060 | Anziaceae | | synonym +78060 | Parmeliaceae | | scientific name +78536 | Euphyllophyta | | scientific name +78536 | euphyllophytes | | equivalent name +79078 | Stylosanthes scabra | | scientific name +79078 | Stylosanthes scabra Vogel, 1838 | | authority +79078 | shrubby stylo | | common name +79236 | Cotton yellow mosaic geminivirus | | equivalent name +79236 | Cotton yellow mosaic virus | | scientific name +79514 | Lamiinae | | scientific name +79514 | Laminae | | synonym +79633 | Hydrobates tethys | | synonym +79633 | Hydrobates tethys (Bonaparte, 1852) | | authority +79633 | Oceanodroma tethys | | scientific name +79633 | Oceanodroma tethys (Bonaparte, 1852) | | authority +79633 | Wedge-rumped storm-petrel | | genbank common name +79652 | Oceanites | | scientific name +79653 | Oceanites oceanicus | | scientific name +79653 | Oceanites oceanicus (Kuhl, 1820) | | authority +79653 | Procellaria oceanica | | synonym +79653 | Procellaria oceanica Kuhl, 1820 | | authority +79653 | Wilson's storm-petrel | | genbank common name +82582 | Apaturinae | | scientific name +82582 | emperor butterflies | | genbank common name +82582 | emperors | emperors | common name +82676 | Omikronpapillomavirus 1 | | scientific name +82676 | Phocoena spinipinnis papillomavirus | | equivalent name +83312 | Apis nigrocincta | | scientific name +83312 | Apis nigrocincta Smith, 1860 | | authority +83321 | Apini | | scientific name +83871 | Chrysanthemum stem necrosis virus | | scientific name +85103 | Burhinidae | | scientific name +85104 | Burhinus | | scientific name +85512 | Dicondylia | | scientific name +85545 | Hydrobatidae | | scientific name +85545 | Hydrobatinae | | synonym +85545 | Oceanitidae | | synonym +85545 | storm petrels | | common name +85604 | Amphiesmenoptera | | scientific name +85817 | Neuroptera group | | includes +85817 | Neuroptera-Megaloptera-Raphidoptera group | | includes +85817 | Neuropterida | | scientific name +85819 | Phthiraptera | | scientific name +85819 | Phthiraptera Haeckel, 1896 | | authority +85819 | lice | lice | blast name +85819 | lice | lice | genbank common name +85823 | Blattaria | | synonym +85823 | Blattodea | | scientific name +85823 | Blattoptera | | synonym +85823 | cockroaches & termites | cockroaches & termites | blast name +85823 | cockroaches & termites | cockroaches & termites | genbank common name +86721 | Kmeria duperreana | | synonym +86721 | Kmeria duperreana (Pierre) Dandy, 1927 | | authority +86721 | Magnolia duperreana | | scientific name +86721 | Magnolia duperreana Pierre, 1880 | | authority +86989 | Emmenopterys | | scientific name +86989 | Emmenopterys Oliv., 1889 | | authority +86990 | Emmenopterys henryi | | scientific name +86990 | Emmenopterys henryi Oliv., 1889 | | authority +87139 | Aetobatus | | scientific name +88159 | Alaria praelonga | | scientific name +88159 | Alaria praelonga Kjellman, 1889 | | authority +88770 | Panarthropoda | | scientific name +89593 | Craniata | Craniata | scientific name +90010 | unclassified Enterovirus | | scientific name +90010 | unclassified Enteroviruses | | equivalent name +91347 | Enterobacterales | | scientific name +91347 | Enterobacterales Adeolu et al. 2016 | | authority +91347 | Enterobacteriaceae and related endosymbionts | | synonym +91347 | Enterobacteriaceae group | | synonym +91347 | Enterobacteriales | | synonym +91347 | gamma-3 proteobacteria | gamma-3 proteobacteria | in-part +91561 | Artiodactyla | | scientific name +91561 | Cetartiodactyla | | synonym +91561 | even-toed ungulates & whales | even-toed ungulates & whales | blast name +91561 | even-toed ungulates & whales | even-toed ungulates & whales | genbank common name +91771 | Megalaimidae | | scientific name +91776 | Psilopogon | | scientific name +91827 | Gunneridae | | scientific name +91827 | Gunneridae D.E.Soltis, P.S.Soltis & W.S.Judd, 2007 | | authority +91827 | core eudicots | | equivalent name +91827 | core eudicotyledons | | equivalent name +91835 | eurosids I | | synonym +91835 | fabids | | scientific name +91836 | eurosids II | | includes +91836 | malvids | | scientific name +91882 | Asteranae | | includes +91882 | campanulids | | scientific name +91882 | euasterids II | | synonym +91888 | Gentiananae | | includes +91888 | euasterids I | | synonym +91888 | lamiids | | scientific name +92738 | Termitinae | | scientific name +92738 | snapping termites | | genbank common name +93386 | Columbid alphaherpesvirus 1 | | scientific name +93386 | Columbid herpesvirus 1 | | equivalent name +93386 | Columbid herpesvirus type 1 | | equivalent name +93386 | Pigeon herpesvirus | | equivalent name +94231 | Epinephelus | | scientific name +94231 | Promicrops | | synonym +94243 | Stromateidae | | scientific name +94243 | butterfishes | | genbank common name +94642 | Besnoitia | | scientific name +94643 | Besnoitia besnoiti | | scientific name +94844 | Ligula | | scientific name +94845 | Fasciola intestinalis | | synonym +94845 | Fasciola intestinalis Linnaeus, 1758 | | authority +94845 | Ligula intestinalis | | scientific name +95179 | Agrotinae | | synonym +95179 | Noctuinae | | scientific name +95337 | Vesivirus | | scientific name +95341 | Sapovirus | | scientific name +95341 | Sapporo-like viruses | | equivalent name +98220 | Alaria crassifolia | | scientific name +98220 | Alaria crassifolia Kjellman, 1885 | | authority +98221 | Alaria marginata | | scientific name +98221 | Alaria marginata Postels & Ruprecht, 1840 | | authority +99756 | Engaeus | | scientific name +100182 | Granada hare | | genbank common name +100182 | Lepus granatensis | | scientific name +100182 | Lepus granatensis Rosenhauer, 1856 | | authority +100750 | Limenitidinae | | scientific name +101203 | Saprolegnia parasitica | | scientific name +102804 | Asteroideae | | scientific name +102804 | Asteroideae Lindl., 1829 | | authority +102805 | Barnadesioideae | | scientific name +102805 | Barnadesioideae (D.Don) Bremer & Jansen, 1992 | | authority +102809 | Astereae | | scientific name +102809 | Astereae Cass., 1819 | | authority +102814 | Heliantheae | | scientific name +102814 | Heliantheae Cass., 1819 | | authority +102818 | Cardueae | | scientific name +102818 | Cardueae Cass., 1819 | | authority +103490 | Cyclobalanopsis gilva | | synonym +103490 | Cyclobalanopsis gilva (Blume) Oerst. | | authority +103490 | Quercus gilva | | scientific name +103490 | Quercus gilva Blume, 1851 | | authority +103723 | Grapevine Red Globe virus | | scientific name +103955 | Corythaixoides | | scientific name +103956 | Corythaix concolor | | synonym +103956 | Corythaix concolor Smith, 1833 | | authority +103956 | Corythaixoides concolor | | scientific name +103956 | Corythaixoides concolor (Smith, A, 1833) | | authority +103956 | Crinifer concolor | | synonym +103956 | Crinifer concolor (Smith, 1833) | | authority +103956 | grey go-away-bird | | genbank common name +104430 | Apoditrysia | | scientific name +104431 | Obtectomera | | scientific name +104435 | Zygaenoidea | | scientific name +104766 | Nanovirus | | scientific name +105711 | Dreissenoidea | | scientific name +106324 | Ascaris osculata | | synonym +106324 | Ascaris osculata Rudolphi, 1802 | | authority +106324 | Contracaecum osculatum | | scientific name +106324 | Contracaecum osculatum (Rudolphi, 1802) | | authority +106324 | Contracaecum osculatum C | | includes +106325 | Contracaecum osculatum baicalensis | | scientific name +106742 | Cyclograpsus | | scientific name +107843 | Hydroporinae | | scientific name +107924 | Porhydrus | | scientific name +110618 | Nectriaceae | | scientific name +110618 | Nectriaceae Tul. & C. Tul., 1865 | | authority +110618 | mitosporic Nectriaceae | | includes +111067 | Pagurus longicarpus | | scientific name +111067 | Pagurus longicarpus Say, 1817 | | authority +111067 | long-clawed hermit crab | | genbank common name +111670 | Cladonia rangiferina | | scientific name +111670 | Cladonia rangiferina (L.) Weber, 1780 | | authority +111670 | Lichen rangiferinus | | synonym +111670 | Lichen rangiferinus L., 1753 | | authority +112415 | Letharia | | scientific name +112415 | Letharia (Th. Fr.) Zahlbr., 1892 | | authority +113113 | Rhinopomastidae | | scientific name +113114 | Rhinopomastus | | scientific name +113115 | Falcinellus cyanomelas | | synonym +113115 | Falcinellus cyanomelas Vieillot, 1819 | | authority +113115 | Rhinopomastus cyanomelas | | scientific name +113115 | common scimitar-bill | | genbank common name +114658 | Bryidae | | scientific name +114658 | Bryidae Engl., 1892 | | authority +115354 | Zygaenidae | | scientific name +115354 | burnets | | genbank common name +115354 | smoky moths | | common name +116704 | Eubrachyura | | scientific name +116707 | Brachyrhyncha | Brachyrhyncha | in-part +116707 | Thoracotremata | | scientific name +117010 | Agaricus constrictus | | synonym +117010 | Agaricus constrictus Fr., 1821 | | authority +117010 | Calocybe constricta | | synonym +117010 | Calocybe constricta (Fr.) Kuhner ex Singer, 1962 | | authority +117010 | Tricholomella constricta | | scientific name +117010 | Tricholomella constricta (Fr.) Zerova ex Kalamees, 1992 | | authority +117570 | Teleostomi | | scientific name +117571 | Euteleostomi | | scientific name +117571 | bony vertebrates | | genbank common name +117574 | unclassified Microviridae | | scientific name +117677 | Phaneropteridae | | synonym +117677 | Phaneropterinae | | scientific name +117677 | broad-winged katydids | | common name +117677 | false katydids | | common name +117677 | leaf katydids | | genbank common name +117678 | Poecilimon | | scientific name +117776 | Acropora divaricata | | scientific name +117776 | Acropora divaricata (Dana, 1846) | | authority +117776 | Acropora stoddarti | | synonym +117776 | Madrepora divaricata | | synonym +117776 | Madrepora divaricata Dana, 1846 | | authority +117778 | Acropora yongei | | scientific name +117778 | Acropora yongei Veron & Wallace, 1984 | | authority +117851 | Myliobatiformes | | scientific name +117893 | Batoidea | | scientific name +117893 | rays | | genbank common name +119089 | Adenophorea | | synonym +119089 | Chromadorea | | scientific name +119164 | Betaluteovirus | | equivalent name +119164 | Polerovirus | | scientific name +119164 | Potleavirus | | equivalent name +119164 | luteovirus subgroup II | | equivalent name +119257 | Endromidae | | scientific name +119257 | Mirinidae | | synonym +119257 | Oberthueriinae | | synonym +119257 | Oberthuerinae | | synonym +119257 | Prismostictinae | | synonym +119257 | glory moths | | genbank common name +120864 | Zeleinae | | scientific name +120865 | Zele | | scientific name +121422 | Phoenicurus | | scientific name +121822 | Calophyidae | | scientific name +121823 | Calophya | | scientific name +121826 | Trioza urticae | | scientific name +122260 | Digramma | | scientific name +122261 | Digramma interrupta | | scientific name +123365 | Neoteleostei | | scientific name +123366 | Eurypterygia | | scientific name +123366 | Eurypterygii | | synonym +123367 | Ctenosquamata | | scientific name +123368 | Acanthomorpha | | synonym +123368 | Acanthomorphata | | scientific name +123369 | Euacanthomorpha | | synonym +123369 | Euacanthomorphacea | | scientific name +123757 | Astrocoeniina | | scientific name +124006 | Cyclorhipidion | | scientific name +124426 | Ustilaginoidea | | scientific name +124426 | Ustilaginoidea Bref., 1895 | | authority +124426 | Villosiclava | | synonym +124426 | Villosiclava E. Tanaka & C. Tanaka, 2009 | | authority +124960 | Iodes | | scientific name +124960 | Iodes Blume, 1825 | | authority +126287 | Didelphinae | | scientific name +127916 | DRIP clade | | synonym +127916 | Ichthyosporea | | scientific name +127916 | Ichthyosporea Cavalier-Smith, 1998 | | authority +127916 | Mesomycetozoa | | synonym +127916 | Mesomycetozoea | | synonym +127916 | Mesomycetozoea Mendoza et al., 2002 | | authority +128790 | BRMV | | acronym +128790 | Bean rugose mosaic virus | | scientific name +128818 | Chinese yam necrotic mosaic virus | | scientific name +129017 | Microhyla | | scientific name +129725 | Foveavirus | | scientific name +130990 | Entransia | | scientific name +130990 | Entransia E.O.Hughes, 1948 | | authority +130991 | Entransia fimbriata | | scientific name +130991 | Entransia fimbriata E.O.Hughes | | authority +131209 | Conjugatophyceae | | synonym +131209 | Gamophyceae | | synonym +131209 | Gamophyta | | synonym +131209 | Zygnematophyceae | | scientific name +131209 | Zygnematophyceae van den Hoek et al., 1995 | | authority +131209 | Zygnemophyceae | | synonym +131209 | conjugating green algae | | common name +131210 | Desmidiales | | scientific name +131210 | Desmidiales Bessey, 1907 | | authority +131210 | desmids | | common name +131211 | Closteriaceae | | scientific name +131211 | Closteriaceae Bessey, 1907 | | authority +131220 | Klebsormidiophyceae | | scientific name +131220 | Klebsormidiophyceae van den Hoek et al., 1995 | | authority +131220 | algae | algae | in-part +131221 | Charophyta/Embryophyta group | | synonym +131221 | Streptophytina | | scientific name +131221 | charophyte/embryophyte group | | equivalent name +131567 | biota | | synonym +131567 | cellular organisms | | scientific name +133550 | Crinozoa | | includes +133550 | Pelmatozoa | | scientific name +135166 | Bucconidae | | scientific name +135167 | Bucco | | scientific name +135168 | Bucco capensis | | scientific name +135168 | Bucco capensis Linnaeus, 1766 | | authority +135168 | collared puffbird | | genbank common name +135425 | Nectariniidae | | scientific name +135426 | Dicaeum | | scientific name +137443 | MHV-1 | | acronym +137443 | Macropodid alphaherpesvirus 1 | | scientific name +137443 | Macropodid herpesvirus 1 | | equivalent name +137443 | Macropodid herpesvirus type 1 | | equivalent name +137443 | Parma wallaby herpesvirus | | synonym +137443 | wallaby herpesvirus | | equivalent name +137757 | Ipomovirus | | scientific name +138977 | Myotis horsfieldii | | scientific name +138977 | Vespertilio horsfieldii | | synonym +138977 | Vespertilio horsfieldii Temminck, 1840 | | authority +140052 | Betaretrovirus | | scientific name +140052 | Type D Retrovirus group | | includes +144051 | Cricket paralysis-like viruses | | equivalent name +144051 | Cripavirus | | scientific name +145388 | Monoraphidium neglectum | | scientific name +145388 | Monoraphidium neglectum Heynig & Krienitz | | authority +145388 | SAG 48.87 | SAG 48.87 | type material +147100 | Rhabditophora | | scientific name +147271 | Paspalum | | scientific name +147271 | Paspalum L., 1759 | | authority +147271 | crowngrass | | common name +147366 | Bambusoideae | | scientific name +147366 | Bambusoideae Luerss., 1893 | | authority +147368 | Pooideae | | scientific name +147368 | Pooideae Benth., 1861 | | authority +147369 | Centothecoideae | | synonym +147369 | Panicoideae | | scientific name +147369 | Panicoideae Link, 1827 | | authority +147370 | PACC clade | | includes +147370 | PACCAD clade | | includes +147370 | PACMAD clade | | scientific name +147376 | Bambuseae | | scientific name +147376 | Bambuseae Kunth ex Dumort., 1829 | | authority +147376 | bamboo | | genbank common name +147377 | Olyreae | | scientific name +147377 | Olyreae Kunth ex Spenn., 1825 | | authority +147387 | Poeae | | scientific name +147387 | Poeae R. Br., 1814 | | authority +147428 | Paniceae | | scientific name +147428 | Paniceae R.Br., 1814 | | authority +147537 | Saccharomycotina | | scientific name +147537 | budding yeasts & allies | budding yeasts & allies | blast name +147537 | budding yeasts & allies | budding yeasts & allies | genbank common name +147537 | true yeasts | | common name +147538 | Euascomycota | | synonym +147538 | Pezizomycotina | | scientific name +147538 | Pezizomycotina O.E. Erikss. & Winka, 1997 | | authority +147538 | filamentous ascomycetes | | genbank common name +147545 | Chaetothyriomycetes | | includes +147545 | Eurotiomycetes | | scientific name +147545 | Eurotiomycetes O.E. Erikss. & Winka, 1997 | | authority +147545 | Loculoascomycetes | Loculoascomycetes | in-part +147545 | Plectomycetes | Plectomycetes | in-part +147545 | bitunicate ascomycetes | bitunicate ascomycetes | in-part +147547 | Lecanoromycetes | | scientific name +147547 | Lecanoromycetes O.E. Erikss. & Winka, 1997 | | authority +147547 | common lichens | | common name +147550 | Pyrenomycetes | Pyrenomycetes | in-part +147550 | Sordariomycetes | | scientific name +147550 | Sordariomycetes O.E. Erikss. & Winka, 1997 | | authority +150311 | Oligolepis | | scientific name +151340 | Papillomaviridae | | scientific name +151340 | Papillomavirus | | equivalent name +151341 | Polyomaviridae | | scientific name +153135 | Gammaretrovirus | | scientific name +153135 | MLV-related viruses | | equivalent name +153135 | Mammalian type C retrovirus group | | equivalent name +153135 | Mammalian type C retroviruses | | equivalent name +153135 | mammalian type C oncoviruses | | equivalent name +153135 | type C oncoviruses | | equivalent name +153286 | Myotis nigricans | | scientific name +153286 | Vespertilio nigricans | | synonym +153286 | Vespertilio nigricans Schinz, 1821 | | authority +153287 | Myotis thysanodes | | scientific name +153287 | Myotis thysanodes Miller, 1897 | | authority +155616 | Heterobasidiomycetes | | synonym +155616 | Tremellomycetes | | scientific name +155616 | Tremellomycetes Doweld, 2001 | | authority +155616 | Tremellomycetidae | | equivalent name +155619 | Agaricomycetes | | scientific name +155619 | Agaricomycetes Doweld, 2001 | | authority +155619 | Agaricomycetidae sensu Kirk et al. 2001 | | includes +155619 | Homobasidiomycetes | | includes +155619 | Hymenomycetidae | | includes +155768 | Pandoroidea | | scientific name +156152 | Antirrhinaceae | | includes +156152 | Callitrichaceae | | includes +156152 | Globulariaceae | | includes +156152 | Gratiolaceae | | includes +156152 | Hippuridaceae | | includes +156152 | Plantaginaceae | | scientific name +156152 | Plantaginaceae Juss., 1789 | | authority +156152 | Scrophulariaceae | Scrophulariaceae | in-part +156152 | Veronicaceae | | includes +156152 | speedwell family | | common name +156208 | Macluravirus | | scientific name +156505 | Cyclograpsus intermedius | | scientific name +156505 | Cyclograpsus intermedius Ortmann, 1894 | | authority +156511 | Macrophthalminae | | scientific name +156760 | Galapagos penguin | | genbank common name +156760 | Spheniscus mendiculus | | scientific name +156760 | Spheniscus mendiculus Sundevall, 1871 | | authority +157270 | Gooseberry vein banding associated virus | | scientific name +157270 | Gooseberry vein banding virus | | equivalent name +157317 | Anastrangalia | | scientific name +157777 | PeSV | | acronym +157777 | Pea streak virus | | scientific name +157822 | Lecanorineae | | scientific name +158330 | Cypripedioideae | | scientific name +158330 | Cypripedioideae Lindl. ex Endl., 1837 | | authority +158332 | Epidendroideae | | scientific name +158332 | Epidendroideae Lindl. ex Endl., 1837 | | authority +158391 | Cymbidieae | | scientific name +158391 | Cymbidieae Pfitzer, 1887 | | authority +158397 | Vandeae | | scientific name +158397 | Vandeae Lindl., 1826 | | authority +158424 | Aeridinae | | scientific name +158424 | Aeridinae Pfitzer, 1887 | | authority +158424 | Saccolabiinae | | includes +159141 | Sathuperi orthobunyavirus | | equivalent name +159141 | Sathuperi virus | | scientific name +159150 | Shamonda orthobunyavirus | | equivalent name +159150 | Shamonda virus | | scientific name +159322 | Myotis albescens | | scientific name +159322 | Vespertilio albescens | | synonym +159322 | Vespertilio albescens Geoffroy Saint-Hilaire, 1806 | | authority +159325 | Myotis dominicensis | | scientific name +159325 | Myotis dominicensis Miller, 1902 | | authority +159332 | Myotis oxyotus | | scientific name +159332 | Vespertilio oxyotus | | synonym +159332 | Vespertilio oxyotus Peters, 1867 | | authority +159333 | Myotis ruber | | scientific name +159333 | Vespertilio ruber | | synonym +159333 | Vespertilio ruber Geoffroy Saint-Hilaire, 1806 | | authority +159335 | Myotis volans | | scientific name +159335 | Vespertilio volans | | synonym +159335 | Vespertilio volans Allen, 1866 | | authority +159337 | Myotis yumanensis | | scientific name +159337 | Vespertilio yumanensis | | synonym +159337 | Vespertilio yumanensis Allen, 1864 | | authority +160079 | Anatoecus | | scientific name +160148 | Troctomorpha | | scientific name +160148 | Troctomorpha Roesler, 1940 | | authority +160394 | Barbatula | | scientific name +162474 | Malasseziales | | scientific name +162474 | Malasseziales R.T. Moore, 1980 | | authority +163125 | Pampus | | scientific name +163611 | Alticorpus | | scientific name +163725 | Dalbergieae | | scientific name +163725 | Dalbergieae Bronn ex DC., 1825 | | authority +163733 | Millettieae | | scientific name +163733 | Millettieae Miq., 1855 | | authority +163735 | Phaseoleae | | scientific name +163735 | Phaseoleae DC., 1925 | | authority +163739 | Euchresteae | | synonym +163739 | Euchresteae H.Ohashi, 1973 | | authority +163739 | Sophoreae | | scientific name +163739 | Sophoreae Spreng. ex DC., 1825 | | authority +163739 | Thermopsideae | | synonym +163739 | Thermopsideae Yakovlev, 1972 | | authority +165250 | Alfalfa latent carlavirus | | equivalent name +165250 | Alfalfa latent virus | | scientific name +165440 | Dioszegia | | scientific name +165440 | Dioszegia Zsolt, 1957 | | authority +165826 | Melon chlorotic leaf curl virus | | scientific name +166052 | Microhylinae | | scientific name +166126 | Seriata | | scientific name +166236 | Bdellouroidea | | scientific name +166243 | Uteriporidae | | scientific name +166244 | Ectoplaninae | | scientific name +166586 | Aedes flavopictus | | scientific name +166586 | Aedes flavopictus Yamada, 1921 | | authority +166784 | Odontobutidae | | scientific name +166784 | freshwater sleepers | | genbank common name +167449 | Gobius lagocephalus | | synonym +167449 | Gobius lagocephalus Pallas, 1770 | | authority +167449 | Sicydium taeniurum | | synonym +167449 | Sicydium taeniurum Guenther, 1877 | | authority +167449 | Sicyopterus lagocephalus | | scientific name +167449 | Sicyopterus lagocephalus (Pallas, 1770) | | authority +167449 | Sicyopterus taeniurus | | synonym +167449 | Sicyopterus taeniurus (Guenther, 1877) | | authority +168496 | Buddleja albiflora var. hemsleyana | | scientific name +168496 | Buddleja albiflora var. hemsleyana (Koehne) C.K.Schneid., 1912 | | authority +168496 | Buddleja hemsleyana | | synonym +168496 | Buddleja hemsleyana Koehne, 1903 | | authority +168834 | Jeffersonia dubia | | synonym +168834 | Jeffersonia dubia (Maxim.) Benth. & Hook. f. ex Baker & Moore | | authority +168834 | Plagiorhegma dubium | | scientific name +168834 | Plagiorhegma dubium Maxim., 1859 | | authority +169417 | Lutrinae | | scientific name +169618 | Ixoroideae | | scientific name +169626 | Condamineeae | | scientific name +170325 | CaHV-1 | | acronym +170325 | Canid alphaherpesvirus 1 | | scientific name +170325 | Canid alphaherpesvirus type 1 | | equivalent name +170325 | Canid herpesvirus 1 | | equivalent name +170325 | Canine herpesvirus | | equivalent name +170325 | Canine herpesvirus 1 | | equivalent name +170325 | canine herpesvirus CHV | | equivalent name +171627 | Fusarium fujikuroi species complex | | scientific name +171627 | Gibberella fujikuroi complex | | synonym +171638 | Rosoideae | | scientific name +171788 | Fulcaldea | | scientific name +171788 | Fulcaldea Poir. | | authority +171944 | Mangifera sylvatica | | scientific name +171944 | Mangifera sylvatica Roxb., 1824 | | authority +171944 | Nepal mango | | common name +172915 | Saurogobio | | scientific name +172976 | Ceramium longissimum | | synonym +172976 | Fucus longissimus | | synonym +172976 | Fucus longissimus S.G.Gmelin, 1768 | | authority +172976 | Gracilaria verrucosa | | synonym +172976 | Gracilaria verrucosa (Hudson) Papenfuss 1950 | | authority +172976 | Gracilariopsis longissima | | scientific name +172976 | Gracilariopsis longissima (S.G.Gmelin) M.Steentoft, L.M.Irvine & W.F.Farnham 1995 | | authority +173087 | Human papillomavirus types | | scientific name +175121 | Passeroidea | | scientific name +175529 | Amazona guildingii | | scientific name +175529 | Psittacus guildingii | | synonym +175529 | Psittacus guildingii Vigors, 1837 | | authority +176938 | Alcedo aenea | | synonym +176938 | Alcedo aenea Pallas, 1764 | | authority +176938 | American pygmy kingfisher | | genbank common name +176938 | Chloroceryle aenea | | scientific name +178830 | Bornaviridae | | scientific name +178941 | Arytainilla | | scientific name +178941 | Arytainilla Loginova, 1972 | | authority +178948 | Arytaina spartii | | synonym +178948 | Arytaina spartii Guerin-Meneville, 1842 | | authority +178948 | Arytainilla spartiophila | | scientific name +178948 | Arytainilla spartiophila (Foerster, 1848) | | authority +178948 | broom psyllid | | genbank common name +180252 | Mardivirus | | scientific name +180252 | Marek's disease-like viruses | | equivalent name +180950 | Tricholomella | | scientific name +180950 | Tricholomella Zerova ex Kalamees, 1992 | | authority +181089 | Aethopyga | | scientific name +181124 | Agaricus oreades | | synonym +181124 | Agaricus oreades Bolton, 1791 | | authority +181124 | Marasmius oreades | | scientific name +181124 | Marasmius oreades (Bolton) Fr., 1836 | | authority +181124 | Scotch bonnet mushroom | | common name +181124 | fairy-ring Marasmius | | genbank common name +181762 | Psilocybe cubensis | | scientific name +181762 | Psilocybe cubensis (Earle) Singer, 1948 | | authority +181762 | Stropharia cubensis | | synonym +181762 | Stropharia cubensis Earle, 1906 | | authority +181762 | magic mushroom | | common name +182093 | unclassified Vesivirus | | scientific name +182724 | Laternulidae | | scientific name +182725 | Laternula | | scientific name +183385 | Hydroporini | | scientific name +183963 | "Halomebacteria" Cavalier-Smith 1986 | "Halomebacteria" Cavalier-Smith 1986 | authority +183963 | Halobacteria | | scientific name +183963 | Halobacteria Grant et al. 2002 | | synonym +183963 | Halobacteria Grant et al. 2002 emend. Gupta et al. 2015 | | authority +183963 | Halomebacteria | Halomebacteria | in-part +183963 | Halomebacteria Cavalier-Smith, 2002 | Halomebacteria Cavalier-Smith, 2002 | authority +184751 | Vitivirus | | scientific name +185002 | Plantago ovata | | scientific name +185002 | Plantago ovata Forssk., 1775 | | authority +185002 | blond plantain | | genbank common name +185002 | blond psyllium | | common name +185002 | desert Indianwheat | | common name +185002 | desert plantain | | common name +185002 | ispaghul | | common name +185751 | Pospiviroidae | | scientific name +185751 | Viroids | Viroids | in-part +185752 | Avsunviroidae | | scientific name +185752 | Viroids | Viroids | in-part +185753 | Pospiviroid | | scientific name +185756 | Apscaviroid | | scientific name +185759 | Pelamoviroid | | scientific name +185786 | tentative aquareoviruses | | equivalent name +185786 | tentative species in the genus Aquareoviruses | | equivalent name +185786 | unclassified Aquareovirus | | scientific name +186121 | Micromus | | scientific name +186458 | Bornavirus | | equivalent name +186458 | Orthobornavirus | | scientific name +186534 | Caulimoviridae | | scientific name +186623 | Actinopteri | | scientific name +186625 | Clupeocephala | | scientific name +186626 | Otophysa | | synonym +186626 | Otophysi | | scientific name +186627 | Cypriniphysae | | scientific name +186627 | Cypriniphysi | | synonym +186634 | Ostarioclupeomorpha | | synonym +186634 | Otocephala | | synonym +186634 | Otomorpha | | scientific name +186766 | Narnaviridae | | scientific name +186767 | Narnavirus | | scientific name +186886 | Pomovirus | | scientific name +186938 | Respirovirus | | scientific name +187214 | Soybean chlorotic mottle-like viruses | | equivalent name +187214 | Soymovirus | | scientific name +190729 | Begomovirus-associated DNA beta-like sequences | | equivalent name +190729 | Betasatellite | | scientific name +190729 | Betasatellites | | equivalent name +190729 | beta satellites | | equivalent name +190729 | satellite DNA beta | | equivalent name +192204 | Corvoidea | | scientific name +192380 | Monochamini | | scientific name +192381 | Monochamus | | scientific name +192382 | Japanese pine sawyer | | genbank common name +192382 | Japanese pine sawyer beetle | | common name +192382 | Monochamus alternatus | | scientific name +192382 | Monochamus alternatus Hope, 1842 | | authority +193267 | Mnais tenuis | | scientific name +193267 | Mnais tenuis Oguma, 1913 | | authority +194960 | Kobuvirus | | scientific name +195059 | Datura yellow vein nucleorhabdovirus | | scientific name +195059 | Datura yellow vein virus | | equivalent name +195633 | Pleuronichthys | | scientific name +195798 | Cladonia rangiferina subsp. rangiferina | | scientific name +197056 | Cladonia rangiferina subsp. abbayesii | | scientific name +197056 | Cladonia rangiferina subsp. abbayesii (Ahti) Ahti & DePriest, 2001 | | authority +197112 | Pear latent virus | | scientific name +197112 | Pear redleaf-associated virus | | synonym +197562 | Pancrustacea | | scientific name +197563 | Mandibulata | | scientific name +197563 | mandibulates | | common name +197613 | Rosa chinensis f. spontanea | | synonym +197613 | Rosa chinensis f. spontanea Rehder & E.H.Wilson, 1815 | | authority +197613 | Rosa chinensis var. spontanea | | scientific name +197613 | Rosa chinensis var. spontanea (Rehder & E.H.Wilson) T.T.Yu & T.C.Ku, 1985 | | authority +197613 | Rosa odorata var. spontanea | | synonym +198607 | Double stranded RNA satellites | | scientific name +198607 | Double-stranded RNA satellites | | equivalent name +198607 | Double-stranded satellite RNAs | | equivalent name +198625 | Eccrinales | | includes +198625 | Ichthyophonida | | scientific name +201863 | Phocine distemper virus 1 | | scientific name +203261 | Epinephelus bleekeri | | scientific name +203261 | Epinephelus bleekeri (Vaillant, 1878) | | authority +203261 | Serranus bleekeri | | synonym +203261 | Serranus bleekeri Vaillant, 1878 | | authority +203261 | duskytail grouper | | genbank common name +205083 | Dreissena rostriformis | | scientific name +205083 | Mytilus rostriformis | | synonym +205083 | Mytilus rostriformis Deshayes, 1838 | | authority +211557 | Apachyidae | | scientific name +211558 | Apachyus | | scientific name +211567 | Apachyoidea | | scientific name +214437 | Spizaetus | | scientific name +215788 | Limenitidini | | scientific name +216794 | Plantagineae | | scientific name +216795 | Veroniceae | | scientific name +216806 | Buddlejeae | | scientific name +216806 | Buddlejeae Bartl., 1830 | | authority +216812 | Scrophularieae | | scientific name +217160 | Ampelovirus | | scientific name +219103 | Carduoideae | | scientific name +219103 | Carduoideae Cass. ex Sweet, 1826 | | authority +220121 | Macrophthaimus diiatatus | | synonym +220121 | Macrophthalmus (Macrophthalmus) abbreviatus | | synonym +220121 | Macrophthalmus abbreviatus | | scientific name +220121 | Macrophthalmus abbreviatus Manning & Holthuis, 1981 | | authority +220121 | Macrophthalmus dilatatus | | synonym +220121 | Ocypode (Macrophthalmus) dilatata | | synonym +220121 | Ocypode dilatata | | synonym +220121 | Ocypode dilatata De Haan, 1835 | | authority +222078 | Ageratum yellow vein China virus - [Hn2] | | scientific name +222078 | Ageratum yellow vein China virus-[Hn2] | | equivalent name +222543 | Hypocreomycetidae | | scientific name +222543 | mitosporic Hypocreomycetidae | | includes +222544 | Sordariomycetidae | | scientific name +222556 | unclassified Nodaviridae | | scientific name +223251 | Soybean crinkle leaf virus-[Japan] | | scientific name +223286 | Melon chlorotic leaf curl virus-[Guatemala] | | scientific name +223769 | Grapevine Anatolian ringspot virus | | scientific name +224510 | Iberoporus | | scientific name +225962 | Sweet potato virus Y | | scientific name +226102 | Aconitum contortum | | scientific name +226102 | Aconitum contortum Finet & Gagnep., 1904 | | authority +227307 | Gyrovirus | | scientific name +228457 | Anatina elliptica | | synonym +228457 | Anatina elliptica King, 1832 | | authority +228457 | Laternula elliptica | | scientific name +228657 | Echinosophora | | scientific name +228657 | Echinosophora Nakai, 1923 | | authority +228658 | Echinosophora koreensis | | scientific name +228658 | Echinosophora koreensis Nakai, 1923 | | authority +228658 | Sophora koreensis | | synonym +229219 | Blastomyces | | scientific name +229219 | Blastomyces Gilchrist & W.R. Stokes, 1898 | | authority +229219 | Emmonsia | | synonym +229219 | Emmonsia Cif. & Montemart., 1959 | | authority +231932 | Peniophora carnosa | | synonym +231932 | Peniophora carnosa Burt, 1926 | | authority +231932 | Phanerochaete carnosa | | scientific name +231932 | Phanerochaete carnosa (Burt) Parmasto, 1967 | | authority +232347 | Magnoliidae | | scientific name +232347 | Magnoliidae Novak ex Takht., 1967 | | authority +232347 | magnoliids | | equivalent name +232795 | Dicistroviridae | | scientific name +232799 | Iflavirus | | scientific name +232799 | Infectious flachery-like viruses | | equivalent name +233784 | Grapevine deformation virus | | scientific name +234792 | Chinese lizard gudgeon | | genbank common name +234792 | Saurogobio dabryi | | scientific name +234792 | Saurogobio dabryi Bleeker, 1871 | | authority +240201 | Burhinus bistriatus | | scientific name +240201 | Charadrius bistriatus | | synonym +240201 | Charadrius bistriatus Wagler, 1829 | | authority +240201 | Hesperoburhinus bistriatus | | synonym +240201 | Hesperoburhinus bistriatus (Wagler, 1829) | | authority +241749 | Arremon | | scientific name +241750 | Arremon aurantiirostris | | scientific name +241750 | Arremon aurantiirostris Lafresnaye, 1847 | | authority +241750 | orange-billed sparrow | | genbank common name +241751 | Arremon aurantiirostris rufidorsalis | | scientific name +241751 | Arremon rufidorsalis | | synonym +241751 | Arremon rufidorsalis Cassin, 1865 | | authority +241778 | Apioideae | | scientific name +241778 | Apioideae Seem., 1866 | | authority +241780 | apioid superclade | | scientific name +241785 | Bupleureae | | scientific name +241785 | Bupleureae Spreng., 1820 | | authority +241792 | Angelica + Arracacia clade | | equivalent name +241792 | Selineae | | scientific name +241792 | Selineae Spreng., 1820 | | authority +241932 | Trophis | | scientific name +241932 | Trophis P. Browne | | authority +246410 | Coccidioides immitis RS | | scientific name +249184 | Tymoviridae | | scientific name +249185 | Maculavirus | | scientific name +249310 | Chrysoviridae | | scientific name +249588 | Mamastrovirus | | scientific name +251095 | Nanoviridae | | scientific name +252798 | Falco tyrannus | | synonym +252798 | Falco tyrannus Wied-Neuwied, 1820 | | authority +252798 | Spizaetus tyrannus | | scientific name +252798 | black hawk-eagle | | genbank common name +255330 | Ipomoea vein mosaic virus | | scientific name +257883 | Myotis evotis | | scientific name +257883 | Vespertilio evotis | | synonym +257883 | Vespertilio evotis Allen, 1864 | | authority +257883 | long-eared Myotis | | genbank common name +260377 | Tomato yellow leaf curl Mali virus | | scientific name +263002 | Ageratum yellow vein virus-[Tomato] | | scientific name +265123 | Quarantine #1146 potyvirus | | scientific name +265963 | Viroids | Viroids | in-part +265963 | unclassified viroids | | scientific name +268499 | Crambidae | | scientific name +268499 | Crambiidae | | synonym +268499 | grass moths | | genbank common name +270256 | Eggplant mottled crinkle virus | | scientific name +272620 | Klebsiella pneumoniae MCG 78578 | | equivalent name +272620 | Klebsiella pneumoniae str. MCG 78578 | | equivalent name +272620 | Klebsiella pneumoniae subsp. pneumoniae ATCC 700721 | | synonym +272620 | Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | | scientific name +272620 | Klebsiella pneumoniae subsp. pneumoniae str. MGH 78578 | | equivalent name +272620 | Klebsiella pneumoniae subsp. pneumoniae strain MGH 78578 | | equivalent name +274794 | Epinephelinae | | scientific name +278169 | Cobitinae | | scientific name +278171 | Nemacheilidae | | scientific name +278171 | Nemacheilinae | | synonym +278205 | Myida | | scientific name +278205 | Myoida | | synonym +283494 | Begomovirus-associated DNA 1-like sequences | | equivalent name +283494 | Begomovirus-associated alphasatellites | | equivalent name +283494 | Geminialphasatellitinae | | scientific name +287184 | Chalcosiinae | | scientific name +287195 | Salvelinus leucomaenis japonicus | | scientific name +290090 | Sida yellow mosaic China virus - [Hainan 8] | | scientific name +290090 | Sida yellow mosaic virus-[China] | | equivalent name +290849 | Human astrovirus GGH-2004 | | scientific name +291027 | unclassified Begomovirus | | scientific name +291027 | unclassified begomoviruses | | equivalent name +291286 | Euphorbia ringspot virus | | scientific name +292474 | Ageratum yellow vein virus-[Tomato2] | | scientific name +292479 | Ageratum yellow vein virus-[Indonesia] | | scientific name +293500 | Zantedeschieae | | scientific name +294824 | Lepturini | | scientific name +299071 | Ajellomycetaceae | | scientific name +299071 | Ajellomycetaceae Unter., J.A. Scott & Sigler, 2004 | | authority +299368 | Evergestinae | | scientific name +301920 | Popenaias | | scientific name +301921 | Popenaias popeii | | scientific name +301921 | Texas hornshell mussel | | common name +301921 | Unio popeii | | synonym +301921 | Unio popeii Lea, 1857 | | authority +306901 | Chaetomium globosum CBS 148.51 | | scientific name +307635 | Spizaetus tyrannus serus | | scientific name +307635 | Spizaetus tyrannus serus Friedmann, 1950 | | authority +310684 | Cheravirus | | scientific name +311227 | Mycoreovirus | | scientific name +311900 | Conurus rupicola | | synonym +311900 | Conurus rupicola Tschudi, 1844 | | authority +311900 | Pyrrhura rupicola | | scientific name +311900 | Pyrrhura rupicola (Tschudi, 1844) | | authority +311900 | black-capped parakeet | | genbank common name +314145 | Laurasiatheria | | scientific name +314146 | Euarchontoglires | | scientific name +314147 | Glires | | scientific name +314147 | Rodents and rabbits | | genbank common name +315357 | Ageratum yellow vein virus-[Tomato3] | | scientific name +315838 | Aulacidae | | scientific name +315840 | Pristaulacus | | scientific name +318529 | Heroini | | scientific name +318546 | Pseudocrenilabrinae | | scientific name +318559 | Cichlasomatinae | | scientific name +319056 | New World cichlids | | scientific name +319058 | Haplochromini | | scientific name +319095 | African cichlids | | scientific name +320454 | Symphysodon aequifasciata aequifasciata | | scientific name +320454 | Symphysodon aequifasciata aequifasciata Pellegrin, 1904 | | authority +320454 | Symphysodon aequifasciatus aequifasciatus | | synonym +320455 | Symphysodon aequifasciata axelrodi | | scientific name +320455 | Symphysodon aequifasciata axelrodi Schultz, 1960 | | authority +320455 | Symphysodon aequifasciatus axelrodi | | synonym +321084 | Circaetus gallicus pectoralis | | synonym +321084 | Circaetus pectoralis | | scientific name +321084 | Circaetus pectoralis Smith, 1829 | | authority +321084 | Circaetus pectoralis Smith,A, 1829 | | authority +321084 | black-chested snake-eagle | | genbank common name +321263 | Myotis auriculus | | scientific name +321263 | Myotis auriculus Baker & Stains, 1955 | | authority +321263 | Myotis evotis auriculus | | synonym +321263 | Myotis evotis auriculus Baker & Stains, 1955 | | authority +321263 | Southwestern Myotis | | genbank common name +323096 | Bambusa ventricosa | | scientific name +323096 | Bambusa ventricosa McClure, 1938 | | authority +323096 | Buddha bamboo | | common name +323096 | Buddha belly bamboo | | genbank common name +323096 | tu tu chu | | common name +323895 | Chusquea culeou | | scientific name +323895 | Chusquea culeou E.Desv., 1854 | | authority +324901 | Marnaviridae | | scientific name +325454 | Deltapapillomavirus | | scientific name +325455 | Gammapapillomavirus | | scientific name +325456 | Iotapapillomavirus | | scientific name +325459 | Epsilonpapillomavirus | | scientific name +325461 | Omikronpapillomavirus | | scientific name +327045 | Orthoretrovirinae | | scientific name +327107 | unclassified Maculavirus | | scientific name +327375 | unclassified Carlavirus | | scientific name +327387 | Tropical soda apple mosaic virus | | scientific name +327770 | Epinephelus tukula | | scientific name +327770 | Epinephelus tukula Morgans, 1959 | | authority +327770 | potato grouper | | genbank common name +328429 | unclassified Polerovirus | | scientific name +328527 | Gnathopogon | | scientific name +329860 | Coliphage ID2 | | equivalent name +329860 | Enterobacteria phage ID2 | | scientific name +330383 | unassigned Tymoviridae | | equivalent name +330383 | unclassified Tymoviridae | | scientific name +333774 | unclassified Papillomaviridae | | scientific name +333921 | Xipapillomavirus | | scientific name +333938 | non-primate mammal papillomaviruses | | scientific name +334425 | Lisianthus necrosis virus | | scientific name +334873 | Chinese silver pomfret | | genbank common name +334873 | Pampus chinensis | | scientific name +334873 | Pampus chinensis (Euphrasen, 1788) | | authority +334873 | Stromateus chinensis | | synonym +334873 | Stromateus chinensis Euphrasen, 1788 | | authority +336476 | unclassified Iflavirus | | scientific name +336633 | unclassified Cripavirus | | scientific name +336635 | unassigned Dicistroviridae | | equivalent name +336635 | unclassified Dicistroviridae | | scientific name +336987 | Tobacco leaf curl Cuba virus | | scientific name +337052 | Deltapapillomavirus 4 | | scientific name +337687 | Muroidea | | scientific name +338153 | Pantherinae | | scientific name +339076 | Chiloschista parishii | | scientific name +339076 | Chiloschista parishii Seidenf., 1988 | | authority +341117 | Misgurnus bipartitus | | scientific name +341117 | Misgurnus bipartitus (Sauvage & Dabry de Thiersant, 1874) | | authority +341117 | Nemacheilus bipartitus | | synonym +341117 | Nemacheilus bipartitus Sauvage & Dabry de Thiersant, 1874 | | authority +341128 | Barbatula barbatula nuda | | synonym +341128 | Barbatula nuda | | scientific name +341128 | Barbatula nuda (Bleeker, 1864) | | authority +341128 | Nemacheilus nudus | | synonym +341128 | Nemacheilus nudus Bleeker, 1864 | | authority +341128 | Orthrias nudus | | synonym +344417 | unclassified Aquabirnavirus | | scientific name +345249 | unclassified Circovirus | | scientific name +346391 | Ageratum yellow vein virus-Pakistan | | scientific name +347957 | unclassified Betaretrovirus | | scientific name +351425 | unclassified Foveavirus | | scientific name +351426 | Asian prunus virus 2 | | scientific name +351428 | Asian prunus virus 3 | | scientific name +352235 | unclassified Thogotovirus | | scientific name +352926 | unclassified Astroviridae | | scientific name +352927 | unclassified Crinivirus | | scientific name +353154 | Theileria annulata Ankara clone C9 | | synonym +353154 | Theileria annulata strain Ankara | | scientific name +353769 | unclassified Gammaretrovirus | | scientific name +354837 | Celaenorrhinus | | scientific name +354837 | Celaenorrhinus Hubner, 1819 | | authority +355688 | Agaricomycetes incertae sedis | | scientific name +355688 | Homobasidiomycetes incertae sedis | | includes +357852 | Angelica likiangensis | | scientific name +357852 | Angelica likiangensis H.Wolff, 1930 | | authority +358814 | Daurian redstart | | genbank common name +358814 | Motacilla aurorea | | synonym +358814 | Motacilla aurorea Pallas, 1776 | | authority +358814 | Phoenicurus auroreus | | scientific name +358814 | Phoenicurus auroreus (Pallas, 1776) | | authority +359160 | BEP clade | | equivalent name +359160 | BOP clade | | scientific name +359505 | Bupleurum angustissimum | | scientific name +359505 | Bupleurum angustissimum (Franch.) Kitag., 1947 | | authority +359505 | Bupleurum falcatum var. angustissimum | | synonym +359505 | Bupleurum falcatum var. angustissimum Franch., 1884 | | authority +361688 | Single stranded DNA satellites | | scientific name +361688 | ssDNA satellites | | equivalent name +361688 | unclassified Single stranded DNA satellites | | equivalent name +361688 | unclassified ssDNA satellites | | equivalent name +364270 | Apiineae | | scientific name +364270 | Apiineae Plunkett & Lowry, 2004 | | authority +367188 | Haladaptatus | | scientific name +367188 | Haladaptatus Savage et al. 2007 | | authority +367188 | Haladaptatus Savage et al. 2007 emend. Cui et al. 2010 | | authority +367188 | Haladaptatus Savage et al. 2007 emend. Roh et al. 2010 | | authority +367682 | Narcissus symptomless virus | | scientific name +368620 | Cherry small circular viroid-like RNA 1 | | scientific name +368620 | cscRNA1 | | equivalent name +369752 | Catharanthus mosaic virus | | scientific name +371833 | unclassified Sapovirus | | scientific name +371917 | Corvus columbianus | | synonym +371917 | Corvus columbianus Wilson, 1811 | | authority +371917 | Nucifraga columbiana | | scientific name +375141 | Camallanidae | | scientific name +375142 | Camallanus | | scientific name +375143 | Camallanus cotti | | scientific name +375143 | Camallanus cotti Fujita, 1927 | | authority +376274 | Homotomidae | | synonym +376274 | Homotominae | | scientific name +376275 | Carsidaridae | | scientific name +377833 | Cubitermes group | | scientific name +377833 | Cubitermitinae | | synonym +379583 | Feliformia | | scientific name +379584 | Caniformia | | scientific name +384633 | Atacama myotis | | genbank common name +384633 | Myotis atacamensis | | scientific name +384633 | Vespertilio atacamensis | | synonym +384633 | Vespertilio atacamensis Lataste, 1892 | | authority +388435 | Lecanoromycetidae | | scientific name +391337 | Tomato yellow leaf curl Mali virus-[Ethiopia] | | scientific name +396331 | Bjerkanderaceae | | synonym +396331 | Hapalopilaceae | | synonym +396331 | Phanerochaetaceae | | scientific name +396331 | Phanerochaetaceae Julich, 1982 | | authority +397273 | Suaeda malacosperma | | scientific name +397273 | Suaeda malacosperma H.Hara, 1942 | | authority +398816 | Tobacco leaf curl Cuba virus - [Jamaica] | | scientific name +399178 | Panthera onca mesembrina | | scientific name +399178 | Patagonian panther | | genbank common name +399254 | Aacanthocnema | | scientific name +399254 | Aacanthocnema Tuthill & Taylor, 1955 | | authority +399255 | Aacanthocnema dobsoni | | scientific name +399255 | Trioza dobsoni | | synonym +399255 | Trioza dobsoni Froggatt, 1903 | | authority +404260 | Bryophytina | | scientific name +404260 | Moss Superclass V | | includes +404297 | Bryanae | | scientific name +404297 | Bryanae (Engl.) Goffinet & W.R.Buck | | authority +405558 | Arracacha mottle virus | | scientific name +410297 | Gerbilliscus | | scientific name +410302 | Bushveld gerbil | | genbank common name +410302 | Gerbilliscus leucogaster | | scientific name +410302 | Tatera leucogaster | | synonym +410302 | bushveld gerbil | | common name +410830 | Trichomonascaceae | | scientific name +410830 | Trichomonascaceae Kurtzman & Robnett, 2007 | | authority +413970 | Anulavirus | | scientific name +416867 | Notospermus | | scientific name +416868 | Lineus geniculatus | | synonym +416868 | Notospermus geniculatus | | scientific name +416868 | Notospermus geniculatus (Delle Chiaje, 1822) | | authority +416868 | Polia geniculata | | synonym +416868 | Polia geniculata Delle Chiaje, 1822 | | authority +418101 | Plasmodium (Vinckeia) | | scientific name +418101 | Vinckeia | | synonym +418103 | Plasmodium | Plasmodium | synonym +418103 | Plasmodium (Plasmodium) | | scientific name +420948 | Aetobatus flagellum | | scientific name +420948 | Aetobatus flagellum (Bloch & Schneider, 1801) | | authority +420948 | Raja flagellum | | synonym +420948 | Raja flagellum Bloch & Schneider, 1801 | | authority +420948 | longheaded eagle ray | | genbank common name +421010 | HiMV | | acronym +421010 | Hippeastrum mosaic virus | | scientific name +421921 | Philodendroideae | | scientific name +421921 | Philodendroideae Engl., 1876 | | authority +422676 | Aconoidasida | | scientific name +422676 | Aconoidasida Mehlhorn et al. 1980 | | authority +422676 | Hematozoa Vivier 1982 | | synonym +423054 | Eimeriorina | | scientific name +423369 | NHMW:91214 | NHMW:91214 | type material +423369 | NMW:91214 | NMW:91214 | type material +423369 | NMW:91214 | NMW:91214 | type material +423369 | Salmo leucomaenis leucomaenis | | synonym +423369 | Salmo leucomaenis leucomaenis Pallas, 1814 | | authority +423369 | Salvelinus leucomaenis leucomaenis | | scientific name +423369 | ZMB:23552 | ZMB:23552 | type material +423369 | ZMB:23563 | ZMB:23563 | type material +423370 | Salvelinus leucomaenis imbrius | | scientific name +423370 | Salvelinus leucomaenis imbrius Jordan & McGregor, 1925 | | authority +425264 | Malassezia restricta CBS 7877 | | scientific name +427924 | Dreissena bugensis | | synonym +427924 | Dreissena bugensis var. profunda | | synonym +427924 | Dreissena rostriformis bugensis | | scientific name +427924 | Dreissena rostriformis bugensis Andrusov, 1897 | | authority +427924 | Dreissena rostriformis bugensis var. profunda | | synonym +427924 | guagga mussel | | common name +427924 | quagga mussel | | genbank common name +431037 | unclassified Roseolovirus | | scientific name +433372 | Spizaetus tyrannus tyrannus | | scientific name +435738 | Camallanoidea | | scientific name +436486 | Dinosauria | | scientific name +436486 | dinosaurs | | common name +436489 | Saurischia | | scientific name +436491 | Theropoda | | scientific name +436492 | Coelurosauria | | scientific name +437064 | Ageratum yellow vein virus- [Taiwan:Taoyuan3:2000] | | equivalent name +437064 | Ageratum yellow vein virus-[Taiwan:Taoyuan3:2000] | | scientific name +437489 | Striacosta | | scientific name +437490 | Richia albicosta | | synonym +437490 | Striacosta albicosta | | scientific name +437490 | Striacosta albicosta (Smith, 1888) | | authority +437490 | western bean cutworm | western bean cutworm | genbank common name +439490 | unassigned ssRNA viruses | | equivalent name +439490 | unclassified ssRNA viruses | | scientific name +441227 | Isophya | | scientific name +441892 | Alaria crispa | | scientific name +441892 | Alaria crispa Kjellman, 1889 | | authority +442243 | Lelecella | | scientific name +442302 | Porcine picobirnavirus | | scientific name +442316 | Herona | | scientific name +445316 | Pseudohelice | | scientific name +446318 | Ageratum yellow vein virus-Ishigaki | | scientific name +447093 | Ajellomyces capsulatus G186AR | | synonym +447093 | Histoplasma capsulatum G186AR | | scientific name +450882 | Taxus fuana | | scientific name +450882 | Taxus fuana Nan Li & R.R.Mill, 1997 | | authority +451864 | Dikarya | | scientific name +451871 | Eurotiomycetidae | | scientific name +452284 | Ustilaginomycotina | | scientific name +452284 | Ustilaginomycotina Doweld, 2001 | | authority +452284 | smut fungi & allies | smut fungi & allies | blast name +452284 | smut fungi & allies | smut fungi & allies | common name +452333 | Agaricomycetidae | | scientific name +453050 | Sweet potato virus 2 | | scientific name +456398 | Chasmagnathus subquadratus | | synonym +456398 | Chasmagnathus subquadratus Dana, 1851 | | authority +456398 | Pseudohelice subquadrata | | scientific name +456398 | Pseudohelice subquadrata (Dana, 1851) | | authority +461132 | Lelecella limenitoides | | scientific name +461132 | Lelecella limenitoides (Oberthur, 1890) | | authority +461132 | Vanessa limenitoides | | synonym +461132 | Vanessa limenitoides Oberthur, 1890 | | authority +464095 | Picornavirales | | scientific name +464925 | environmental samples | environmental samples | scientific name +469369 | Ocinara | | scientific name +473626 | Barbitistini | | scientific name +473674 | Poecilimon birandi | | synonym +473674 | Poecilimon birandi Karabag, 1950 | | authority +473674 | Poecilimon luschani birandi | | scientific name +473674 | Poecilimon luschani birandi Karabag, 1950 | | authority +473713 | Poecilimon luschani | | scientific name +473713 | Poecilimon luschani Ramme, 1933 | | authority +473783 | unclassified Umbravirus | | scientific name +473784 | Opium poppies mosaic virus | | equivalent name +473784 | Opium poppy mosaic umbravirus | | equivalent name +473784 | Opium poppy mosaic virus | | scientific name +474943 | Cordycipitaceae | | scientific name +474943 | Cordycipitaceae Kreisel ex G.H. Sung, J.M. Sung, Hywel-Jones & Spatafora, 2007 | | authority +474943 | mitosporic Cordycipitaceae | | includes +475272 | Ernolatia | | scientific name +475273 | Ernolatia moorei | | scientific name +475273 | Ernolatia moorei (Hutton, 1865) | | authority +475273 | Ocinara moorei | | synonym +475273 | Ocinara moorei Hutton, 1865 | | authority +475327 | Bombycinae | | scientific name +475347 | Prismosticta | | scientific name +475348 | Prismosticta fenestrata | | scientific name +475348 | Prismosticta fenestrata Butler, 1880 | | authority +478825 | unclassified Picornaviridae | | scientific name +481315 | Leporid alphaherpesvirus 4 | | scientific name +481315 | Leporid herpesvirus 4 | | equivalent name +484021 | Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 | | scientific name +484021 | Klebsiella pneumoniae subsp. pneumoniae str. NTUH-K2044 | | equivalent name +484021 | Klebsiella pneumoniae subsp. pneumoniae strain NTUH-K2044 | | equivalent name +485724 | Melon severe mosaic tospovirus | | equivalent name +485724 | melon severe mosaic virus | | scientific name +490134 | Hepatitis B virus Woolly monkey/Louisville | | scientific name +490134 | Woolly monkey hepatitis B virus (isolate Louisville) | | equivalent name +493796 | Human astrovirus Hu/CMH053/01/2001/THA | | scientific name +493797 | Human astrovirus Hu/CMH074/01/2001/THA | | scientific name +493798 | Human astrovirus Hu/CMH259/01/2001/THA | | scientific name +493799 | Human astrovirus Hu/CMH265/00/2000/THA | | scientific name +493800 | Human astrovirus Hu/CMH350/02/2002/THA | | scientific name +493801 | Human astrovirus Hu/CMH352/02/2002/THA | | scientific name +493802 | Human astrovirus Hu/CMH362/01/2001/THA | | scientific name +494651 | Bovine hokovirus | | equivalent name +494651 | Bovine hokovirus 1 | | scientific name +497220 | Gobionellinae | | scientific name +497679 | Sicydiinae | | scientific name +498257 | Verticillium dahliae VdLs.17 | | scientific name +501251 | Ageratum yellow vein virus - [G129] | | scientific name +501252 | Ageratum yellow vein virus - [G130] | | scientific name +504568 | Salmoninae | | scientific name +504568 | trouts, salmons & chars | | genbank common name +516546 | Cirsium japonicum | | scientific name +516546 | Cirsium japonicum DC., 1838 | | authority +526119 | unclassified Mamastrovirus | | scientific name +535378 | Dytiscoidea | | scientific name +535382 | Caraboidea | | scientific name +535600 | unclassified Parvoviridae | | scientific name +538002 | Cordyceps militaris cf. var. sphaerocephala MRCIF64 | | scientific name +547124 | unclassified Mycoreovirus | | scientific name +547455 | Paspalum virgatum | | scientific name +547455 | Paspalum virgatum L., 1759 | | authority +548681 | Herpesvirales | | scientific name +548688 | Percavirus | | scientific name +552816 | Engaeus lengana | | scientific name +552816 | Engaeus lengana Horwitz, 1990 | | authority +554155 | Arthroderma otae CBS 113480 | | synonym +554155 | Microsporum canis CBS 113480 | | scientific name +554155 | Microsporum canis CBS113480 | | synonym +558016 | Alphabaculovirus | | scientific name +558016 | Nucleopolyhedrovirus | Nucleopolyhedrovirus | in-part +558017 | Betabaculovirus | | scientific name +558017 | GV | | acronym +558017 | Granulosis viruses | | equivalent name +558017 | Granulovirus | | equivalent name +558690 | Cucurbit chlorotic yellows virus | | scientific name +559297 | Ajellomyces dermatitidis ER-3 | | synonym +559297 | Blastomyces dermatitidis ER-3 | | scientific name +559298 | Ajellomyces dermatitidis SLH#14081 | | equivalent name +559298 | Ajellomyces dermatitidis SLH14081 | | equivalent name +559298 | Blastomyces dermatitidis SLH14081 | | equivalent name +559298 | Blastomyces gilchristii SLH14081 | | scientific name +559305 | Trichophyton rubrum CBS 118892 | | scientific name +560253 | Letharia lupina | | scientific name +560253 | Letharia lupina Altermann, Goward & Leavitt, 2016 | | authority +560253 | Letharia sp. Altermann EP3a | | includes +560253 | Letharia sp. SA-2008b | | includes +560253 | UC 2049992 | UC 2049992 | type material +564644 | Endornaviridae | | scientific name +569360 | Fusarium graminearum species complex | | includes +569360 | Fusarium sambucinum species complex | | scientific name +569578 | PX clade | | scientific name +569578 | algae | algae | in-part +570949 | Carrot mottle mimic virus satellite RNA | | scientific name +570950 | Carrot mottle virus satellite RNA | | scientific name +578617 | Porcine kobuvirus swine/2007/CHN | | scientific name +584378 | Aegosomatini | | scientific name +585893 | Picobirnaviridae | | scientific name +590647 | Nariva virus | | scientific name +590745 | Mus musculus mobilized endogenous polytropic provirus | | scientific name +626155 | Human astrovirus 1 Beijing/04/2006/CHN | | scientific name +626156 | Human astrovirus 1 Beijing/102/2005/CHN | | scientific name +626157 | Human astrovirus 1 Beijing/106/2005/CHN | | scientific name +626158 | Human astrovirus 1 Beijing/110/2007/CHN | | scientific name +626159 | Human astrovirus 1 Beijing/113/2005/CHN | | scientific name +626160 | Human astrovirus 1 Beijing/128/2005/CHN | | scientific name +626161 | Human astrovirus 1 Beijing/134/2005/CHN | | scientific name +626162 | Human astrovirus 1 Beijing/139/2005/CHN | | scientific name +626163 | Human astrovirus 1 Beijing/141/2005/CHN | | scientific name +626164 | Human astrovirus 1 Beijing/176/2006/CHN | | scientific name +626165 | Human astrovirus 1 Beijing/180/2005/CHN | | scientific name +626166 | Human astrovirus 1 Beijing/183/2006/CHN | | scientific name +626167 | Human astrovirus 1 Beijing/189/2005/CHN | | scientific name +626168 | Human astrovirus 1 Beijing/189/2007/CHN | | scientific name +626169 | Human astrovirus 1 Beijing/198/2005/CHN | | scientific name +626170 | Human astrovirus 1 Beijing/204/2005/CHN | | scientific name +626171 | Human astrovirus 1 Beijing/210/2006/CHN | | scientific name +626172 | Human astrovirus 1 Beijing/214/2005/CHN | | scientific name +626173 | Human astrovirus 1 Beijing/234/2005/CHN | | scientific name +626174 | Human astrovirus 1 Beijing/234/2006/CHN | | scientific name +626175 | Human astrovirus 1 Beijing/237/2005/CHN | | scientific name +626176 | Human astrovirus 1 Beijing/239/2005/CHN | | scientific name +626177 | Human astrovirus 1 Beijing/249/2005/CHN | | scientific name +626178 | Human astrovirus 1 Beijing/254/2007/CHN | | scientific name +626179 | Human astrovirus 1 Beijing/287/2005/CHN | | scientific name +626180 | Human astrovirus 1 Beijing/291/2007/CHN | | scientific name +626181 | Human astrovirus 1 Beijing/293/2007/CHN | | scientific name +626182 | Human astrovirus 1 Beijing/309/2007/CHN | | scientific name +626183 | Human astrovirus 1 Beijing/317/2007/CHN | | scientific name +626184 | Human astrovirus 1 Beijing/327/2007/CHN | | scientific name +626185 | Human astrovirus 1 Beijing/330/2007/CHN | | scientific name +626186 | Human astrovirus 1 Beijing/335/2007/CHN | | scientific name +626187 | Human astrovirus 1 Beijing/347/2007/CHN | | scientific name +626188 | Human astrovirus 1 Beijing/352/2007/CHN | | scientific name +626189 | Human astrovirus 1 Beijing/362/2007/CHN | | scientific name +626190 | Human astrovirus 1 Beijing/375/2007/CHN | | scientific name +626191 | Human astrovirus 1 Beijing/377/2007/CHN | | scientific name +626192 | Human astrovirus 1 Beijing/41/2005/CHN | | scientific name +626193 | Human astrovirus 1 Beijing/46/2005/CHN | | scientific name +626194 | Human astrovirus 1 Beijing/60/2007/CHN | | scientific name +626195 | Human astrovirus 1 Beijing/69/2007/CHN | | scientific name +626196 | Human astrovirus 1 Beijing/79/2006/CHN | | scientific name +626197 | Human astrovirus 1 Beijing/82/2007/CHN | | scientific name +626198 | Human astrovirus 6 Beijing/192/2007/CHN | | scientific name +632743 | Human astrovirus 1d | | scientific name +640623 | Aveninae | | scientific name +640623 | Aveninae J.Presl, 1830 | | authority +642248 | unclassified Circoviridae | | scientific name +642994 | Herona marathus | | scientific name +642994 | Herona marathus Doubleday, 1848 | | authority +644269 | Kumanoa | | scientific name +644269 | Kumanoa Entwisle, M.L.Vis, W.B.Chiasson, Necchi & A.R.Sherwood, 2009 | | authority +645133 | Colletotrichum graminicola M1.001 | | scientific name +645133 | Glomerella graminicola M1.001 | | equivalent name +649996 | Tomato yellow leaf distortion virus | | scientific name +650164 | Phanerochaete carnosa HHB-10118-sp | | scientific name +652723 | Porcine kobuvirus THA/2001-2003 | | scientific name +652811 | Human astrovirus 1 Beijing/01/2005/CHN | | scientific name +652812 | Human astrovirus 1 Beijing/06/2006/CHN | | scientific name +652813 | Human astrovirus 1 Beijing/129/2005/CHN | | scientific name +652814 | Human astrovirus 1 Beijing/131/2007/CHN | | scientific name +652815 | Human astrovirus 1 Beijing/228/2005/CHN | | scientific name +652816 | Human astrovirus 1 Beijing/265/2005/CHN | | scientific name +652817 | Human astrovirus 1 Beijing/33/2005/CHN | | scientific name +652818 | Human astrovirus 1 Beijing/333/2007/CHN | | scientific name +652819 | Human astrovirus 1 Beijing/75/2005/CHN | | scientific name +652820 | Human astrovirus 3 Beijing/124/2007/CHN | | scientific name +654128 | Marasmiaceae | | scientific name +654128 | Marasmiaceae Roze ex Kuhner, 1980 | | authority +654128 | mitosporic Marasmiaceae | | includes +667127 | Klebsiella pneumoniae subsp. rhinoscleromatis ATCC 13884 | | scientific name +667127 | Klebsiella pneumoniae subsp. rhinoscleromatis str. ATCC 13884 | | equivalent name +667127 | Klebsiella pneumoniae subsp. rhinoscleromatis strain ATCC 13884 | | equivalent name +667151 | Dicaeum concolor | | scientific name +667151 | Dicaeum concolor Jerdon, 1840 | | authority +667167 | Dicaeidae | | scientific name +667516 | Nakiwogo virus | | scientific name +667725 | Sphaeroforma arctica JP610 | | scientific name +674952 | Trichomonasvirus | | scientific name +674953 | Trichomonas vaginalis virus 1 | | scientific name +674981 | Victorivirus | | scientific name +674996 | Cotton leaf curl Shadadpur virus | | includes +674996 | Cotton leaf curl Shahdadpur virus | | scientific name +675063 | Tymovirales | | scientific name +675064 | Alphaflexiviridae | | scientific name +675064 | Flexiviridae | Flexiviridae | in-part +675068 | Betaflexiviridae | | scientific name +675068 | Flexiviridae | Flexiviridae | in-part +675071 | Virgaviridae | | scientific name +675072 | Comoviridae | | includes +675072 | Secoviridae | | scientific name +675072 | Sequiviridae | | includes +675073 | Torradovirus | | scientific name +675074 | unassigned Picornavirales | | equivalent name +675074 | unclassified Picornavirales | | scientific name +675075 | Comovirinae | | scientific name +675845 | Emaravirus | | scientific name +676044 | Malvastrum yellow vein Honghe virus | | scientific name +676058 | Acropora nobilis | | synonym +676058 | Acropora nobilis (Dana, 1846) | | authority +676058 | Acropora robusta | | scientific name +676058 | Acropora robusta (Dana, 1846) | | authority +676058 | Madrepora robusta | | synonym +676058 | Madrepora robusta Dana, 1846 | | authority +681501 | Olmedia caucana | | synonym +681501 | Olmedia caucana Pittier, 1912 | | authority +681501 | Trophis caucana | | scientific name +681501 | Trophis caucana (Pittier) C.C.Berg, 1988 | | authority +681950 | Glomerellaceae | | scientific name +681950 | Glomerellaceae Locq. ex Seifert & W. Gams, 2007 | | authority +681950 | mitosporic Glomerellaceae | | includes +685445 | Enterobacter aerogenes FGI35 | | synonym +685445 | Enterobacter aerogenes str. FGI35 | | equivalent name +685445 | Enterobacter aerogenes strain FGI35 | | equivalent name +685445 | Enterobacter sp. FGI 35 | | synonym +685445 | Klebsiella aerogenes FGI35 | | scientific name +685899 | Papaya lethal yellowing virus | | scientific name +686565 | Gokushovirinae | | scientific name +686982 | Sapelovirus | | scientific name +687091 | Evergestis | | scientific name +687329 | Anelloviridae | | scientific name +687329 | Anellovirus | | equivalent name +687332 | Betatorquevirus | | scientific name +687339 | Iotatorquevirus | | scientific name +687387 | TTSV1b | | acronym +687387 | Torque teno sus virus 1b | | scientific name +687387 | Torque teno sus virus 2 | | equivalent name +693996 | Alphacoronavirus | | scientific name +693996 | Coronavirus | Coronavirus | in-part +693996 | Coronavirus group 1 | | equivalent name +693996 | Coronavirus group 1b | | includes +693996 | Group 1 species | | equivalent name +693997 | Alphacoronavirus 1 | | scientific name +693997 | Alphacoronavirus-1 | | equivalent name +695850 | Saprolegnia parasitica CBS 223.65 | | scientific name +696855 | Nebovirus | | scientific name +699189 | Iflaviridae | | scientific name +702736 | Chelonid alphaherpesvirus 5 | | scientific name +702736 | Chelonid herpesvirus 5 | | equivalent name +703582 | Porcine kobuvirus swine/K-30-HUN/2008/HUN | | scientific name +706525 | Phocoena phocoena papillomavirus 1 | | scientific name +706526 | Phocoena phocoena papillomavirus 2 | | scientific name +706527 | Phocoena phocoena papillomavirus 4 | | scientific name +706622 | Scaritinae | | scientific name +706663 | Himerometridae | | scientific name +706663 | Zygometridae | | synonym +707741 | Zygometra | | scientific name +715989 | sordariomyceta | | scientific name +716545 | saccharomyceta | | scientific name +716546 | leotiomyceta | | scientific name +735337 | Euheterodonta | | scientific name +735504 | unclassified Gammapapillomavirus | | scientific name +742010 | Carduinae | | scientific name +742010 | Carduinae Dumort., 1827 | | authority +742845 | Malasseziaceae | | scientific name +742845 | Malasseziaceae Denchev & R.T. Moore, 2009 | | authority +742914 | Cyclovirus | | scientific name +742914 | suggested genus Cyclovirus | | equivalent name +748365 | Aspiorhynchus | | scientific name +748366 | Aspiorhynchus laticeps | | scientific name +748366 | Aspiorhynchus laticeps (Day, 1877) | | authority +748366 | Ptychobarbus laticeps | | synonym +748366 | Ptychobarbus laticeps Day, 1877 | | authority +748366 | big-head schizothoracin | | genbank common name +753343 | Histia | | scientific name +759124 | Bhendi yellow vein mosaic alphasatellite | | scientific name +759124 | Bhendi yellow vein mosaic virus alphasatellite | | equivalent name +759804 | Porcine kobuvirus Japan/2009 | | scientific name +763898 | Anastrangalia reyi sequensi | | synonym +763898 | Anastrangalia sequensi | | scientific name +763898 | Anastrangalia sequensi (Reitter, 1898) | | authority +763898 | Anoplodera sequensi | | synonym +763898 | Anoplodera sequensi Li, Chen & Lin, 1981 | | authority +766764 | Debaryomycetaceae | | scientific name +766764 | Debaryomycetaceae Kurtzman & M. Suzuki, 2010 | | authority +766764 | Debaryomycetaceae Kurtzman et M. Suzuki 2010 | | authority +796900 | Kobuvirus pig/Ch-kobu/2008/CHN | | scientific name +796901 | Kobuvirus pig/Ch1/2008/CHN | | scientific name +796902 | Kobuvirus pig/Ch13/2008/CHN | | scientific name +796903 | Kobuvirus pig/Ch14/2008/CHN | | scientific name +796904 | Kobuvirus pig/Ch16/2008/CHN | | scientific name +796905 | Kobuvirus pig/Ch39/2008/CHN | | scientific name +796906 | Kobuvirus pig/Ch4/2008/CHN | | scientific name +796907 | Kobuvirus pig/Ch40/2008/CHN | | scientific name +796908 | Kobuvirus pig/Ch41/2008/CHN | | scientific name +796909 | Kobuvirus pig/Ch5/2008/CHN | | scientific name +796910 | Kobuvirus pig/Ch6/2008/CHN | | scientific name +797075 | Nerine latent virus | | scientific name +861365 | Klebsiella pneumoniae subsp. rhinoscleromatis SB3432 | | scientific name +861365 | Klebsiella pneumoniae subsp. rhinoscleromatis str. SB3432 | | equivalent name +861365 | Klebsiella pneumoniae subsp. rhinoscleromatis strain SB3432 | | equivalent name +861561 | Cyrtanthus elatus virus A | | scientific name +861561 | Vallota speciosa virus - Narcissus/AUS/2008 | | equivalent name +871765 | Porcine TTV 2 | | equivalent name +871765 | Porcine torque teno virus 2 | | scientific name +885375 | Kobuvirus swine/MF8045/2009/KOR | | scientific name +885376 | Kobuvirus swine/MF8047/2009/KOR | | scientific name +886583 | Australasian lineages | | scientific name +906906 | Human astrovirus 1 Tianjin/114/2008/CHN | | scientific name +906907 | Human astrovirus 1 Tianjin/124/2008/CHN | | scientific name +906908 | Human astrovirus 1 Tianjin/133/2008/CHN | | scientific name +906909 | Human astrovirus 1 Tianjin/217/2008/CHN | | scientific name +906910 | Human astrovirus 1 Tianjin/242/2008/CHN | | scientific name +906911 | Human astrovirus 1 Tianjin/499/2008/CHN | | scientific name +906912 | Human astrovirus 1 Tianjin/508/2008/CHN | | scientific name +906913 | Human astrovirus 1 Tianjin/565/2008/CHN | | scientific name +908833 | unclassified Narnavirus | | scientific name +908834 | Grapevine associated narnavirus-1 | | scientific name +911341 | Heliantheae alliance | | scientific name +930979 | Lyophyllaceae | | scientific name +930979 | Lyophyllaceae Julich, 1982 | | authority +935296 | Enterobacter aerogenes EA1509E | | synonym +935296 | Enterobacter aerogenes str. EA1509E | | equivalent name +935296 | Enterobacter aerogenes strain EA1509E | | equivalent name +935296 | Klebsiella aerogenes EA1509E | | scientific name +935650 | Psipapillomavirus | | scientific name +936057 | Rhopapillomavirus | | scientific name +936058 | Upsilonpapillomavirus | | scientific name +938257 | Kobuvirus swine/South Korea/2010 | | scientific name +939922 | unclassified Victorivirus | | scientific name +940834 | Equine papillomavirus 3 | | equivalent name +940834 | Equus caballus papillomavirus 3 | | scientific name +941259 | Klebsiella pneumoniae U-0608239 | | scientific name +941259 | Klebsiella pneumoniae str. U-0608239 | | equivalent name +941259 | Klebsiella pneumoniae strain U-0608239 | | equivalent name +943329 | Angelica longicaudata | | scientific name +943329 | Angelica longicaudata C.Q.Yuan & R.H.Shan, 1985 | | authority +944994 | Hollyhock yellow vein mosaic virus | | scientific name +977912 | Orsay nodavirus | | equivalent name +977912 | Orsay virus | | scientific name +983644 | Cordyceps militaris CM01 | | scientific name +988644 | ssRNA negative-strand viruses | | equivalent name +988644 | unassigned ssRNA negative-strand viruses | | equivalent name +988644 | unclassified ssRNA negative-strand viruses | | scientific name +990925 | Klebsiella pneumoniae subsp. pneumoniae KPX | | scientific name +990925 | Klebsiella pneumoniae subsp. pneumoniae str. KPX | | equivalent name +990925 | Klebsiella pneumoniae subsp. pneumoniae strain KPX | | equivalent name +992212 | Phlebovirus HB29/China/2010 | | equivalent name +992212 | SFTS virus HB29 | | scientific name +992212 | SFTSV HB29 | | equivalent name +994805 | Andean white-eared opossum | | genbank common name +994805 | Didelphis pernigra | | scientific name +994805 | Didelphis pernigra (Allen, 1900) | | authority +994805 | Didelphis pernigra J. A. Allen, 1900 | | authority +997078 | Tomato leaf curl Comoros virus | | scientific name +1003875 | Sicyoeae | | scientific name +1003875 | Sicyoeae Schrad., 1838 | | authority +1005902 | Porcine kobuvirus THA/2006 | | scientific name +1005903 | Porcine kobuvirus THA/2007 | | scientific name +1005904 | Porcine kobuvirus THA/2008 | | scientific name +1006621 | Cymbidiinae | | scientific name +1006621 | Cymbidiinae Benth., 1881 | | authority +1028307 | Enterobacter aerogenes KCTC 2190 | | synonym +1028307 | Enterobacter aerogenes str. KCTC 2190 | | equivalent name +1028307 | Enterobacter aerogenes strain KCTC 2190 | | equivalent name +1028307 | Klebsiella aerogenes KCTC 2190 | | scientific name +1028384 | Glomerellales | | scientific name +1028384 | Glomerellales Chadef. ex Reblova, W. Gams & Seifert, 2011 | | authority +1032459 | Megalaima haemacephala cebuensis | | synonym +1032459 | Megalaima haemacephala cebuensis Dziadosz & Parkes, 1984 | | authority +1032459 | Psilopogon haemacephalus cebuensis | | scientific name +1032460 | Megalaema haemacephala celestinoi | | synonym +1032460 | Megalaema haemacephala celestinoi Gilliard, 1949 | | authority +1032460 | Megalaima haemacephala celestinoi | | synonym +1032460 | Megalaima haemacephala celestinoi Gilliard, 1949 | | authority +1032460 | Psilopogon haemacephalus celestinoi | | scientific name +1032461 | Megalaema haemacephala delica | | synonym +1032461 | Megalaema haemacephala delica Parrot, 1907 | | authority +1032461 | Megalaima haemacephala delica | | synonym +1032461 | Megalaima haemacephala delica Parrot, 1907 | | authority +1032461 | Psilopogon haemacephalus delicus | | scientific name +1032462 | Bucco haemacephalus haemacephalus | | synonym +1032462 | Bucco haemacephalus haemacephalus Muller, 1776 | | authority +1032462 | Megalaima haemacephala haemacephala | | synonym +1032462 | Megalaima haemacephala haemacephala (Statius Mller, 1776) | | authority +1032462 | Psilopogon haemacephalus haemacephalus | | scientific name +1032463 | Bucco indicus | | synonym +1032463 | Bucco indicus Latham, 1790 | | authority +1032463 | Megalaima haemacephala indica | | synonym +1032463 | Megalaima haemacephala indica (Latham, 1790) | | authority +1032463 | Psilopogon haemacephalus indicus | | scientific name +1032464 | Megalaima haemacephala intermedia | | synonym +1032464 | Megalaima haemacephala intermedia (Shelley, 1891) | | authority +1032464 | Psilopogon haemacephalus intermedius | | scientific name +1032464 | Xantholaema intermedia | | synonym +1032464 | Xantholaema intermedia Shelley, 1891 | | authority +1032465 | Megalaima haemacephala mindanensis | | synonym +1032465 | Megalaima haemacephala mindanensis Rand, 1948 | | authority +1032465 | Psilopogon haemacephalus mindanensis | | scientific name +1032466 | Bucco roseus | | synonym +1032466 | Bucco roseus Dumont, 1805 | | authority +1032466 | Megalaima haemacephala rosea | | synonym +1032466 | Megalaima haemacephala rosea (Dumont, 1816) | | authority +1032466 | Psilopogon haemacephalus roseus | | scientific name +1033976 | Bean necrotic mosaic virus | | scientific name +1033978 | Plectosphaerellaceae | | scientific name +1033978 | Plectosphaerellaceae W.Gams, Summerbell & Zare 2007 | | authority +1033978 | mitosporic Plectosphaerellaceae | | includes +1034061 | Bartramiales | | scientific name +1034061 | Bartramiales M.Menzel, 1992 | | authority +1035782 | Chinese rice frog | | common name +1035782 | Microhyla mixtura | | scientific name +1035782 | Microhyla mixtura Liu and Hu, 1966 | | authority +1036719 | Verticillium | | scientific name +1036719 | Verticillium Nees, 1816 | | authority +1037890 | Klebsiella pneumoniae JH1 | | scientific name +1037890 | Klebsiella pneumoniae str. JH1 | | equivalent name +1037890 | Klebsiella pneumoniae strain JH1 | | equivalent name +1037908 | Klebsiella pneumoniae 1162281 | | scientific name +1037908 | Klebsiella pneumoniae str. 1162281 | | equivalent name +1037908 | Klebsiella pneumoniae strain 1162281 | | equivalent name +1046402 | Potato virus H | | scientific name +1048227 | Porcine kobuvirus/BRA10/2009/Brazil | | scientific name +1048228 | Porcine kobuvirus/BRA24/2009/Brazil | | scientific name +1048229 | Porcine kobuvirus/BRA36/2009/Brazil | | scientific name +1048230 | Porcine kobuvirus/BRA74/2009/Brazil | | scientific name +1048231 | Porcine kobuvirus/BRA788-3/2009/Brazil | | scientific name +1048232 | Porcine kobuvirus/NLD45/2008/Netherlands | | scientific name +1048233 | Porcine kobuvirus/NLD47/2008/Netherlands | | scientific name +1048436 | Human astrovirus VA2 | | scientific name +1048668 | Cotton leaf curl Multan alphasatellite | | scientific name +1048668 | Cotton leaf curl Multan virus alphasatellite | | equivalent name +1048854 | Munguba virus | | scientific name +1049565 | Klebsiella pneumoniae KCTC 2242 | | scientific name +1049565 | Klebsiella pneumoniae str. KCTC 2242 | | equivalent name +1049565 | Klebsiella pneumoniae strain KCTC 2242 | | equivalent name +1049657 | Blattoidea | | scientific name +1050903 | Pepper cryptic virus 2 | | scientific name +1054649 | Beauveria bassiana RNA virus 1 | | scientific name +1054649 | Beauveria bassiana virus 1 | | equivalent name +1056880 | Neurachne muelleri | | scientific name +1056880 | Neurachne muelleri Hack., 1895 | | authority +1056880 | Paraneurachne muelleri | | synonym +1056880 | Paraneurachne muelleri (Hack.) S.T.Blake, 1972 | | authority +1056966 | Aedini | | scientific name +1070324 | Bos taurus papillomavirus 12 | | scientific name +1070324 | Bovine papillomavirus 12 | | equivalent name +1070324 | Bovine papillomavirus type 12 | | equivalent name +1070408 | Human papillomavirus 135 | | scientific name +1070408 | Human papillomavirus type 135 | | equivalent name +1070409 | Human papillomavirus 136 | | scientific name +1070409 | Human papillomavirus type 136 | | equivalent name +1070410 | human papillomavirus 137 | | scientific name +1070413 | Human papillomavirus 140 | | scientific name +1070413 | Human papillomavirus type 140 | | equivalent name +1070417 | Human papillomavirus 144 | | scientific name +1070417 | Human papillomavirus type 144 | | equivalent name +1071164 | Kobuvirus swine/China/2010 | | scientific name +1073966 | unclassified Sapelovirus | | scientific name +1074486 | Klebsiella pneumoniae 1191100241 | | scientific name +1074486 | Klebsiella pneumoniae str. 1191100241 | | equivalent name +1074486 | Klebsiella pneumoniae strain 1191100241 | | equivalent name +1075431 | Alticorpus geoffreyi | | scientific name +1075431 | Alticorpus geoffreyi Snoeks & Walapa, 2004 | | authority +1077831 | unclassified Narnaviridae | | scientific name +1077832 | Phytophthora infestans RNA virus 4 | | scientific name +1080004 | Fulcaldea stuessyi | | scientific name +1080004 | Fulcaldea stuessyi Roque & V.A.Funk, 2011 | | authority +1080924 | Bracon chlorophthalmus | | synonym +1080924 | Bracon chlorophthalmus Spinola, 1808 | | authority +1080924 | Zele chlorophthalmus | | scientific name +1080924 | Zele chlorophthalmus (Spinola, 1808) | | authority +1087440 | Klebsiella pneumoniae subsp. pneumoniae KPNIH1 | | scientific name +1087441 | Klebsiella pneumoniae subsp. pneumoniae KPNIH2 | | scientific name +1087442 | Klebsiella pneumoniae subsp. pneumoniae KPNIH3 | | scientific name +1087443 | Klebsiella pneumoniae subsp. pneumoniae KPNIH4 | | scientific name +1087444 | Klebsiella pneumoniae subsp. pneumoniae KPNIH5 | | scientific name +1087445 | Klebsiella pneumoniae subsp. pneumoniae KPNIH6 | | scientific name +1087446 | Klebsiella pneumoniae FCF1305 | | scientific name +1087447 | Klebsiella pneumoniae FCF3SP | | scientific name +1094167 | Klebsiella pneumoniae subsp. pneumoniae KPNIH7 | | scientific name +1094168 | Klebsiella pneumoniae subsp. pneumoniae KPNIH8 | | scientific name +1094169 | Klebsiella pneumoniae subsp. pneumoniae KPNIH9 | | scientific name +1094170 | Klebsiella pneumoniae subsp. pneumoniae KPNIH10 | | scientific name +1094171 | Klebsiella pneumoniae subsp. pneumoniae KPNIH11 | | scientific name +1096141 | Bovine hokovirus 2 | | scientific name +1111709 | unclassified Iflaviridae | | scientific name +1112098 | Oceanites oceanicus exasperatus | | scientific name +1112098 | Oceanites oceanicus exasperatus Mathews, 1912 | | authority +1114942 | Pig stool associated circular ssDNA virus GER2011 | | scientific name +1115383 | Cycas szechuanensis | | scientific name +1115383 | Cycas szechuanensis W.C.Cheng & L.K.Fu, 1975 | | authority +1115692 | Cannabis cryptic virus | | scientific name +1123862 | Klebsiella pneumoniae subsp. pneumoniae Kp13 | | scientific name +1123862 | Klebsiella pneumoniae subsp. pneumoniae str. Kp13 | | equivalent name +1123862 | Klebsiella pneumoniae subsp. pneumoniae strain Kp13 | | equivalent name +1124990 | Klebsiella pneumoniae cifa_HP1 | | scientific name +1124990 | Klebsiella pneumoniae str. cifa_HP1 | | equivalent name +1124990 | Klebsiella pneumoniae strain cifa_HP1 | | equivalent name +1125630 | Klebsiella pneumoniae subsp. pneumoniae HS11286 | | scientific name +1125630 | Klebsiella pneumoniae subsp. pneumoniae str. HS11286 | | equivalent name +1125630 | Klebsiella pneumoniae subsp. pneumoniae strain HS11286 | | equivalent name +1128946 | Klebsiella pneumoniae subsp. pneumoniae KPNIH12 | | scientific name +1128947 | Klebsiella pneumoniae subsp. pneumoniae KPNIH13 | | scientific name +1128948 | Klebsiella pneumoniae subsp. pneumoniae KPNIH14 | | scientific name +1128949 | Klebsiella pneumoniae subsp. pneumoniae KPNIH15 | | scientific name +1128950 | Klebsiella pneumoniae subsp. pneumoniae KPNIH16 | | scientific name +1128951 | Klebsiella pneumoniae subsp. pneumoniae KPNIH17 | | scientific name +1128952 | Klebsiella pneumoniae subsp. pneumoniae KPNIH18 | | scientific name +1128953 | Klebsiella pneumoniae subsp. pneumoniae KPNIH19 | | scientific name +1128954 | Klebsiella pneumoniae subsp. pneumoniae KPNIH20 | | scientific name +1132022 | Kobuvirus swine/South Korea/2011 | | scientific name +1133751 | Artemisia sobemovirus A | | equivalent name +1133751 | Artemisia virus A | | scientific name +1136133 | Porcine kobuvirus SH-W-CHN/2010/China | | scientific name +1136150 | Scrophularia cephalantha | | scientific name +1136150 | Scrophularia cephalantha Nakai, 1938 | | authority +1156497 | Pichiaceae | | scientific name +1156497 | Pichiaceae M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority +1156497 | Pichiaceae Zender, 1925 | | authority +1156769 | Pig Kobuvirus isolates | | equivalent name +1156769 | Porcine kobuvirus | | scientific name +1158979 | Myliobatidae | | scientific name +1159556 | Claviceps virens | | synonym +1159556 | Claviceps virens M. Sakurai ex Nakata 1934 | | authority +1159556 | MAFF 240994 | MAFF 240994 | type material +1159556 | MAFF 240995 | MAFF 240995 | type material +1159556 | TNS:F-18423 | TNS:F-18423 | type material +1159556 | Ustilaginoidea virens | | scientific name +1159556 | Ustilaginoidea virens (Cooke) Takah., 1896 | | authority +1159556 | Ustilago virens | | synonym +1159556 | Ustilago virens Cooke, 1878 | | authority +1159556 | Villosiclava virens | | synonym +1159556 | Villosiclava virens (Y. Sakurai ex Nakata) E. Tanaka & C. Tanaka 2009 | | authority +1159556 | rice false smut | | common name +1159795 | Dreissena rostriformis compressa | | scientific name +1159795 | Dreissena rostriformis compressa Logvinenko & Starobogatov, 1966 | | authority +1159796 | Dreissena rostriformis distincta | | scientific name +1159796 | Dreissena rostriformis distincta Andrusov, 1897 | | authority +1159796 | Dreissena rostriformis var. distincta | | synonym +1159798 | Dreissena grimmi | | synonym +1159798 | Dreissena rostriformis grimmi | | scientific name +1159798 | Dreissena rostriformis grimmi Andrusov, 1890 | | authority +1162296 | Klebsiella pneumoniae subsp. pneumoniae DSM 30104 | | includes +1162296 | Klebsiella pneumoniae subsp. pneumoniae DSM 30104 = JCM 1662 = NBRC 14940 | | scientific name +1162296 | Klebsiella pneumoniae subsp. pneumoniae JCM 1662 | | includes +1162296 | Klebsiella pneumoniae subsp. pneumoniae NBRC 14940 | | includes +1162296 | Klebsiella pneumoniae subsp. pneumoniae str. DSM 30104 | | equivalent name +1162296 | Klebsiella pneumoniae subsp. pneumoniae strain DSM 30104 | | equivalent name +1162297 | Klebsiella pneumoniae subsp. pneumoniae LCT-KP214 | | scientific name +1162297 | Klebsiella pneumoniae subsp. pneumoniae str. LCT-KP214 | | equivalent name +1162297 | Klebsiella pneumoniae subsp. pneumoniae strain LCT-KP214 | | equivalent name +1168062 | Klebsiella pneumoniae subsp. pneumoniae KPNIH21 | | scientific name +1168062 | Klebsiella pneumoniae subsp. pneumoniae str. KPNIH21 | | equivalent name +1168062 | Klebsiella pneumoniae subsp. pneumoniae strain KPNIH21 | | equivalent name +1168063 | Klebsiella pneumoniae subsp. pneumoniae KPNIH22 | | scientific name +1168063 | Klebsiella pneumoniae subsp. pneumoniae str. KPNIH22 | | equivalent name +1168063 | Klebsiella pneumoniae subsp. pneumoniae strain KPNIH22 | | equivalent name +1168064 | Klebsiella pneumoniae subsp. pneumoniae KPNIH23 | | scientific name +1168064 | Klebsiella pneumoniae subsp. pneumoniae str. KPNIH23 | | equivalent name +1168064 | Klebsiella pneumoniae subsp. pneumoniae strain KPNIH23 | | equivalent name +1170422 | Loreto virus | | scientific name +1170424 | Negev virus | | scientific name +1170425 | Piura virus | | scientific name +1170656 | Vinca leaf curl virus | | scientific name +1172985 | Jingmen tick virus | | scientific name +1172985 | Mogiana tick virus | | equivalent name +1173713 | CGMCC 5.2175 | CGMCC 5.2175 | type material +1173713 | Ganoderma sichuanense | | scientific name +1173713 | Ganoderma sichuanense J. D. Zhao & X. Q. Zhang, 1983 | | authority +1173713 | HMAS 252081 | HMAS 252081 | type material +1173763 | Klebsiella pneumoniae NES 14 | | scientific name +1173763 | Klebsiella pneumoniae str. NES 14 | | equivalent name +1173763 | Klebsiella pneumoniae strain NES 14 | | equivalent name +1176516 | Rosoideae incertae sedis | | scientific name +1177045 | Human astrovirus 1a | | scientific name +1177046 | Human astrovirus 2c | | scientific name +1177047 | Human astrovirus 4a | | scientific name +1177153 | Klebsiella pneumoniae subsp. pneumoniae LZ | | scientific name +1177153 | Klebsiella pneumoniae subsp. pneumoniae str. LZ | | equivalent name +1177153 | Klebsiella pneumoniae subsp. pneumoniae strain LZ | | equivalent name +1182518 | Maize streak Reunion virus | | scientific name +1183241 | Persimmon cryptic virus | | scientific name +1185359 | Bat sapovirus TLC58/HK | | scientific name +1185418 | Klebsiella pneumoniae subsp. pneumoniae ST512-K30BO | | scientific name +1185418 | Klebsiella pneumoniae subsp. pneumoniae str. ST512-K30BO | | equivalent name +1185418 | Klebsiella pneumoniae subsp. pneumoniae strain ST512-K30BO | | equivalent name +1185419 | Klebsiella pneumoniae subsp. pneumoniae ST258-K26BO | | scientific name +1185419 | Klebsiella pneumoniae subsp. pneumoniae str. ST258-K26BO | | equivalent name +1185419 | Klebsiella pneumoniae subsp. pneumoniae strain ST258-K26BO | | equivalent name +1185420 | Klebsiella pneumoniae subsp. pneumoniae ST258-K28BO | | scientific name +1185420 | Klebsiella pneumoniae subsp. pneumoniae str. ST258-K28BO | | equivalent name +1185420 | Klebsiella pneumoniae subsp. pneumoniae strain ST258-K28BO | | equivalent name +1187973 | California sea lion picobirnavirus | | equivalent name +1187973 | Otarine picobirnavirus | | scientific name +1188990 | Vallota speciosa virus | | scientific name +1193292 | Klebsiella pneumoniae subsp. pneumoniae 1084 | | scientific name +1193292 | Klebsiella pneumoniae subsp. pneumoniae str. 1084 | | equivalent name +1193292 | Klebsiella pneumoniae subsp. pneumoniae strain 1084 | | equivalent name +1195163 | Amazon lily mild mottle virus | | equivalent name +1195163 | Anulavirus ALMMV | | scientific name +1195641 | Sida yellow mosaic China virus | | scientific name +1195776 | Pleuronichthys japonicus | | scientific name +1195776 | Pleuronichthys japonicus Suzuki, Kawashima & Nakabo, 2009 | | authority +1196387 | Batrachospermum mahlacense | | synonym +1196387 | Batrachospermum mahlacense Kumano & W.A.Bowden-Kerby, 1986 | | authority +1196387 | Kumanoa mahlacensis | | scientific name +1196387 | Kumanoa mahlacensis (Kumano et W. A. Bowden-Kerby) M. L. Vis, Necchi, W. B. Chiasson et Entwisle 2012 | | authority +1196474 | Aster falcifolius | | scientific name +1196474 | Aster falcifolius Hand.-Mazz., 1937 | | authority +1196494 | Aster pycnophyllus | | scientific name +1196494 | Aster pycnophyllus Franch. ex Diels, 1912 | | authority +1199150 | Klebsiella pneumoniae subsp. pneumoniae KP5-1 | | scientific name +1200970 | French bean leaf curl virus - [India:Kanpur:2011] | | scientific name +1200970 | French bean leaf curl virus-Kanpur | | equivalent name +1200971 | French bean leaf curl betasatellite-Kanpur | | scientific name +1202142 | Citrus chlorotic dwarf associated virus | | scientific name +1202142 | Citrus chlorotic dwarf-associated virus | | equivalent name +1203539 | MW polyomavirus | | scientific name +1203539 | MWPyV strain MA095 | | equivalent name +1203544 | Klebsiella pneumoniae WGLW1 | | synonym +1203544 | Klebsiella pneumoniae subsp. pneumoniae WGLW1 | | scientific name +1203545 | Klebsiella pneumoniae WGLW2 | | synonym +1203545 | Klebsiella pneumoniae subsp. pneumoniae WGLW2 | | scientific name +1203546 | Klebsiella pneumoniae WGLW3 | | synonym +1203546 | Klebsiella pneumoniae subsp. pneumoniae WGLW3 | | scientific name +1203547 | Klebsiella pneumoniae WGLW5 | | synonym +1203547 | Klebsiella pneumoniae subsp. pneumoniae WGLW5 | | scientific name +1205678 | Klebsiella pneumoniae subsp. pneumoniae B5055 | | equivalent name +1205678 | Klebsiella pneumoniae subsp. pneumoniae CIP 52.145 | | equivalent name +1205678 | Klebsiella pneumoniae subsp. pneumoniae CIP 52.145 = B5055 | | scientific name +1206794 | Ecdysozoa | | scientific name +1206795 | Lophotrochozoa | | scientific name +1208309 | Deltapolyomavirus decihominis | | scientific name +1208309 | Human polyomavirus 10 | | equivalent name +1209932 | BBA 70349 | BBA 70349 | type material +1209932 | CBS 126529 | CBS 126529 | type material +1209932 | Colletotrichum scovillei | | scientific name +1209932 | Colletotrichum scovillei Damm, P.F. Cannon & Crous, 2012 | | authority +1209932 | Colletotrichum sp. UD-2012t | | includes +1212766 | Klebsiella pneumoniae subsp. pneumoniae ST258-490 | | scientific name +1212766 | Klebsiella pneumoniae subsp. pneumoniae str. ST258-490 | | equivalent name +1212766 | Klebsiella pneumoniae subsp. pneumoniae strain ST258-490 | | equivalent name +1213620 | Bhanja virus | | scientific name +1214274 | Aedes flavopictus downsi | | scientific name +1214274 | Aedes flavopictus downsi Bohart & Ingram, 1946 | | authority +1214275 | Aedes flavopictus miyarai | | scientific name +1214275 | Aedes flavopictus miyarai Tanaka, Mizusawa & Saugstad, 1979 | | authority +1214955 | GyV4 | GyV4 | acronym +1214955 | Gyrovirus 4 | | scientific name +1216472 | Bat hepatitis E virus | | scientific name +1216472 | Bat hepevirus | | equivalent name +1217821 | Sibine fusca densovirus | | scientific name +1218098 | Klebsiella pneumoniae subsp. ozaenae NBRC 105683 | | scientific name +1219210 | Cordyceps militaris CM-whu | | scientific name +1221206 | Soybean chlorotic spot virus | | scientific name +1221208 | Papilio polyxenes densovirus | | scientific name +1221437 | Grapevine virus F | | scientific name +1221521 | Klebsiella pneumoniae HCNHY1 | | scientific name +1223561 | CAS virus | | scientific name +1223562 | Golden Gate virus | | scientific name +1224679 | Diphyllobothriidea | | scientific name +1225181 | Klebsiella pneumoniae subsp. pneumoniae KPNIH24 | | scientific name +1225182 | Klebsiella pneumoniae subsp. pneumoniae KPNIH25 | | scientific name +1225183 | Klebsiella pneumoniae subsp. pneumoniae KPNIH26 | | scientific name +1226115 | Klebsiella pneumoniae subsp. pneumoniae KpQ3 | | scientific name +1226115 | Klebsiella pneumoniae subsp. pneumoniae str. KpQ3 | | equivalent name +1226115 | Klebsiella pneumoniae subsp. pneumoniae strain KpQ3 | | equivalent name +1226680 | Klebsiella pneumoniae subsp. pneumoniae Ecl8 | | scientific name +1228988 | Klebsiella pneumoniae subsp. pneumoniae KpMDU1 | | scientific name +1230847 | Micromus angulatus | | scientific name +1230847 | Micromus angulatus (Stephens, 1836) | | authority +1231296 | unclassified Begomovirus-associated alphasatellites | | scientific name +1231522 | CBS 7798 | CBS 7798 | type material +1231522 | Candida duobushaemuli Cend.-Bueno, Kolecka, Alastr.-Izq., Gomez-Lopez, Cuenc.-Estr. & Boekhout, 2012 | | synonym +1231522 | Candida duobushaemulonii | | synonym +1231522 | Candidozyma duobushaemuli | | scientific name +1231522 | Candidozyma duobushaemuli (Cend.-Bueno, Kolecka, Alastr.-Izq., Gomez-Lopez, Cuenc.-Estr. & Boekhout, 2012) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai, 2024 | | authority +1231522 | NRRL Y-17802 | NRRL Y-17802 | type material +1231522 | NRRL-Y-17802 | NRRL-Y-17802 | type material +1231522 | NRRL:Y-17802 | NRRL:Y-17802 | type material +1231522 | NRRLY-17802 | NRRLY-17802 | type material +1231523 | CNM CL-7239 | CNM CL-7239 | type material +1231523 | CNM-CL-7239 | CNM-CL-7239 | type material +1231523 | CNM:CL-7239 | CNM:CL-7239 | type material +1231523 | CNMCL-7239 | CNMCL-7239 | type material +1231523 | CNMCL7239 | CNMCL7239 | type material +1231523 | Candida haemuli var. vulneris Cend.-Bueno, Kolecka, Alastr.-Izq., Gomez-Lopez, Cuenc.-Estr. & Boekhout, 2012 | | synonym +1231523 | Candida haemuloni var. vulnera | | synonym +1231523 | Candidozyma haemuli var. vulneris | | scientific name +1231523 | Candidozyma haemuli var. vulneris (Cend.-Bueno, Kolecka, Alastr.-Izq., Gomez-Lopez, Cuenc.-Estr. & Boekhout) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai, 2024 | | authority +1232392 | Klebsiella pneumoniae subsp. pneumoniae KpO3210 | | scientific name +1232637 | Scutavirus | | scientific name +1233522 | unclassified Nebovirus | | scientific name +1236101 | Klebsiella pneumoniae JHCK1 | | scientific name +1236101 | Klebsiella pneumoniae str. JHCK1 | | synonym +1236102 | Klebsiella pneumoniae VA360 | | scientific name +1236102 | Klebsiella pneumoniae str. VA360 | | synonym +1236400 | Pan troglodytes troglodytes polyomavirus 1 | | scientific name +1236676 | Cubitermes ugandensis | | synonym +1236676 | Cubitermes ugandensis (Fuller, 1923) | | authority +1236676 | Cubitermes ugandensis Fuller, 1923 | | authority +1236676 | Isognathotermes ugandensis | | scientific name +1236676 | Isognathotermes ugandensis (Fuller, 1923) | | authority +1238886 | unclassified Torradovirus | | scientific name +1239565 | Mamastrovirus 1 | | scientific name +1239565 | Mamastrovirus-1 | | equivalent name +1241370 | Okra leaf curl Oman virus | | scientific name +1241918 | Le Blanc nodavirus | | scientific name +1244085 | Klebsiella pneumoniae CG43 | | scientific name +1248396 | Human papillomavirus 156 | | scientific name +1248396 | Human papillomavirus type 156 | | equivalent name +1249508 | unclassified Hepacivirus | | scientific name +1250315 | RNA satellites | | scientific name +1250520 | Klebsiella pneumoniae RYC492 | | scientific name +1263871 | Klebsiella pneumoniae ATCC BAA-2146 | | scientific name +1267897 | Klebsiella pneumoniae hvKP1 | | scientific name +1268974 | Klebsiella pneumoniae subsp. pneumoniae Kp001 | | scientific name +1269006 | Klebsiella pneumoniae 909957 | | scientific name +1272960 | Yata virus | | scientific name +1273128 | KLCuB | | acronym +1273128 | Kenaf leaf curl betasatellite | | scientific name +1274605 | Human astrovirus 1/ICMH642Astro/2006/BD | | scientific name +1274606 | Human astrovirus 1/ICMH666Astro/2006/BD | | scientific name +1274607 | Human astrovirus 6/ICMH108Astro/2005/BD | | scientific name +1274608 | Human astrovirus 6/ICMH433Astro/2006/BD | | scientific name +1274609 | Human astrovirus 1/ICMH590Astro/2006/BD | | scientific name +1274610 | Human astrovirus 1/ICMH573Astro/2006/BD | | scientific name +1274611 | Human astrovirus 1/ICMH469Astro/2006/BD | | scientific name +1274613 | Human astrovirus 1/GUP216Astro/2005/TR | | scientific name +1274614 | Human astrovirus 5/GUP125Astro/2005/TR | | scientific name +1274615 | Human astrovirus 1/GUP024Astro/2004/TR | | scientific name +1276652 | Klebsiella pneumoniae ATCC BAA-1705 | | scientific name +1276653 | Klebsiella pneumoniae 700603 | | scientific name +1278288 | Pethia | | scientific name +1279040 | Klebsiella pneumoniae PR04 | | scientific name +1279099 | Sclerotinia sclerotiorum mitovirus 3 | | scientific name +1280412 | Conoidasida | | scientific name +1280412 | Conoidasida Levine 1988 | | authority +1284787 | Klebsiella pneumoniae UHKPC40 | | scientific name +1284788 | Klebsiella pneumoniae UHKPC23 | | scientific name +1284789 | Klebsiella pneumoniae UHKPC28 | | scientific name +1284790 | Klebsiella pneumoniae UHKPC05 | | scientific name +1284791 | Klebsiella pneumoniae UHKPC47 | | scientific name +1284792 | Klebsiella pneumoniae UHKPC67 | | scientific name +1284793 | Klebsiella pneumoniae UHKPC69 | | scientific name +1284794 | Klebsiella pneumoniae UHKPC77 | | scientific name +1284795 | Klebsiella pneumoniae UHKPC96 | | scientific name +1284796 | Klebsiella pneumoniae DMC0526 | | scientific name +1284797 | Klebsiella pneumoniae DMC0799 | | scientific name +1284798 | Klebsiella pneumoniae DMC1097 | | scientific name +1284799 | Klebsiella pneumoniae DMC1316 | | scientific name +1284800 | Klebsiella pneumoniae UHKPC61 | | scientific name +1284801 | Klebsiella pneumoniae UHKPC48 | | scientific name +1284802 | Klebsiella pneumoniae UHKPC33 | | scientific name +1284803 | Klebsiella pneumoniae UHKPC59 | | scientific name +1284804 | Klebsiella pneumoniae UHKPC07 | | scientific name +1284805 | Klebsiella pneumoniae UHKPC17 | | scientific name +1284806 | Klebsiella pneumoniae UHKPC18 | | scientific name +1284807 | Klebsiella pneumoniae UHKPC31 | | scientific name +1284808 | Klebsiella pneumoniae UHKPC06 | | scientific name +1284809 | Klebsiella pneumoniae UHKPC02 | | scientific name +1284810 | Klebsiella pneumoniae UHKPC09 | | scientific name +1284811 | Klebsiella pneumoniae UHKPC01 | | scientific name +1284812 | Klebsiella pneumoniae UHKPC81 | | scientific name +1284813 | Klebsiella pneumoniae UHKPC27 | | scientific name +1284814 | Klebsiella pneumoniae UHKPC 52 | | scientific name +1284815 | Klebsiella pneumoniae UHKPC24 | | scientific name +1284816 | Klebsiella pneumoniae UHKPC26 | | scientific name +1284817 | Klebsiella pneumoniae UHKPC57 | | scientific name +1284818 | Klebsiella pneumoniae UHKPC179 | | scientific name +1284819 | Klebsiella pneumoniae UHKPC45 | | scientific name +1284820 | Klebsiella pneumoniae UHKPC22 | | scientific name +1284821 | Klebsiella pneumoniae UHKPC29 | | scientific name +1284822 | Klebsiella pneumoniae UHKPC32 | | scientific name +1284823 | Klebsiella pneumoniae UHKPC04 | | scientific name +1284824 | Klebsiella pneumoniae VAKPC252 | | scientific name +1284825 | Klebsiella pneumoniae VAKPC254 | | scientific name +1284826 | Klebsiella pneumoniae VAKPC269 | | scientific name +1284827 | Klebsiella pneumoniae VAKPC278 | | scientific name +1284828 | Klebsiella pneumoniae VAKPC280 | | scientific name +1284829 | Klebsiella pneumoniae VAKPC270 | | scientific name +1284830 | Klebsiella pneumoniae VAKPC276 | | scientific name +1284831 | Klebsiella pneumoniae VAKPC297 | | scientific name +1284832 | Klebsiella pneumoniae VAKPC309 | | scientific name +1284833 | Klebsiella pneumoniae KP-7 | | scientific name +1284834 | Klebsiella pneumoniae KP-11 | | scientific name +1285372 | Klebsiella pneumoniae KP_H5500 | | scientific name +1285373 | Klebsiella pneumoniae KPM_nasey | | scientific name +1285596 | Megabirnaviridae | | scientific name +1285597 | Megabirnavirus | | scientific name +1290996 | Klebsiella pneumoniae KP3-S | | scientific name +1292273 | Obrimoposthia | | scientific name +1293059 | Macrophthalmidae | | scientific name +1293356 | Paspaleae | | scientific name +1293356 | Paspaleae J.Presl, 1830 | | authority +1293359 | Paspalinae | | scientific name +1293359 | Paspalinae Griseb., 1846 | | authority +1293364 | Neurachninae | | scientific name +1293364 | Neurachninae Clayton & Renvoize, 1986 | | authority +1294138 | Klebsiella pneumoniae KP5-R | | scientific name +1294139 | Klebsiella pneumoniae KP4-R | | scientific name +1294140 | Klebsiella pneumoniae KP1-I | | scientific name +1294141 | Klebsiella pneumoniae KP2-R | | scientific name +1294269 | Klebsiella pneumoniae HSL4 | | scientific name +1298631 | Turncurtovirus | | scientific name +1298633 | Aichivirus C | | equivalent name +1298633 | Kobuvirus cebes | | scientific name +1299309 | Alphanecrovirus | | scientific name +1300166 | Klebsiella pneumoniae subsp. pneumoniae JCM 20051 | | scientific name +1300981 | Porcine kobuvirus H1/2010/USA | | scientific name +1300982 | Porcine kobuvirus H10/2012/USA | | scientific name +1300983 | Porcine kobuvirus H11/2012/USA | | scientific name +1300984 | Porcine kobuvirus H12/2012/USA | | scientific name +1300985 | Porcine kobuvirus H13/2012/USA | | scientific name +1300986 | Porcine kobuvirus H14/2012/USA | | scientific name +1300987 | Porcine kobuvirus H15/2012/USA | | scientific name +1300988 | Porcine kobuvirus H16/2012/USA | | scientific name +1300989 | Porcine kobuvirus H17/2012/USA | | scientific name +1300990 | Porcine kobuvirus H18/2012/USA | | scientific name +1300991 | Porcine kobuvirus H19/2012/USA | | scientific name +1300992 | Porcine kobuvirus H2/2010/USA | | scientific name +1300993 | Porcine kobuvirus H20/2012/USA | | scientific name +1300994 | Porcine kobuvirus H21/2012/USA | | scientific name +1300995 | Porcine kobuvirus H22/2012/USA | | scientific name +1300996 | Porcine kobuvirus H23/2012/USA | | scientific name +1300997 | Porcine kobuvirus H24/2012/USA | | scientific name +1300998 | Porcine kobuvirus H25/2012/USA | | scientific name +1300999 | Porcine kobuvirus H3/2010/USA | | scientific name +1301000 | Porcine kobuvirus H4/2010/USA | | scientific name +1301001 | Porcine kobuvirus H5/2012/USA | | scientific name +1301002 | Porcine kobuvirus H6/2012/USA | | scientific name +1301003 | Porcine kobuvirus H7/2012/USA | | scientific name +1301004 | Porcine kobuvirus H8/2012/USA | | scientific name +1301005 | Porcine kobuvirus H9/2012/USA | | scientific name +1301006 | Porcine kobuvirus M1/2012/USA | | scientific name +1301007 | Porcine kobuvirus M10/2012/USA | | scientific name +1301008 | Porcine kobuvirus M2/2012/USA | | scientific name +1301009 | Porcine kobuvirus M3/2012/USA | | scientific name +1301010 | Porcine kobuvirus M4/2012/USA | | scientific name +1301011 | Porcine kobuvirus M5/2012/USA | | scientific name +1301012 | Porcine kobuvirus M6/2012/USA | | scientific name +1301013 | Porcine kobuvirus M7/2012/USA | | scientific name +1301014 | Porcine kobuvirus M8/2012/USA | | scientific name +1301015 | Porcine kobuvirus M9/2012/USA | | scientific name +1302145 | Aethopyga gouldiae | | scientific name +1302145 | Aethopyga gouldiae (Vigors, 1831) | | authority +1302145 | Cinnyris gouldiae | | synonym +1302145 | Cinnyris gouldiae Vigors, 1831 | | authority +1302145 | Gould's sunbird | | genbank common name +1303385 | Tomato leaf curl Liwa virus | | scientific name +1304916 | Klebsiella pneumoniae 140_1040 | | scientific name +1304917 | Klebsiella pneumoniae 160_1080 | | scientific name +1304918 | Klebsiella pneumoniae 120_1020 | | scientific name +1304919 | Klebsiella pneumoniae 280_1220 | | scientific name +1304920 | Klebsiella pneumoniae 361_1301 | | scientific name +1304921 | Klebsiella pneumoniae 440_1540 | | scientific name +1304922 | Klebsiella pneumoniae 500_1420 | | scientific name +1304923 | Klebsiella pneumoniae 540_1460 | | scientific name +1304924 | Klebsiella pneumoniae 646_1568 | | scientific name +1306546 | ALCV | | acronym +1306546 | Alfalfa leaf curl virus | | equivalent name +1306546 | Capulavirus medicagonis | | scientific name +1306950 | Klebsiella pneumoniae 12-3578 | | synonym +1306950 | Klebsiella pneumoniae subsp. pneumoniae 12-3578 | | scientific name +1307798 | Negevirus | | scientific name +1307799 | Pegivirus | | scientific name +1307958 | Sweet potato C6 virus | | scientific name +1307958 | Sweet potato virus C-6 | | equivalent name +1308539 | Klebsiella pneumoniae subsp. pneumoniae ATCC 43816 | | scientific name +1308684 | Klebsiella pneumoniae ADL-122 | | scientific name +1308684 | Klebsiella pneumoniae ADL-22 | | equivalent name +1308685 | Klebsiella pneumoniae ADL-201 | | scientific name +1308685 | Klebsiella pneumoniae ADL-25 | | equivalent name +1308686 | Klebsiella pneumoniae ADL-202 | | scientific name +1308686 | Klebsiella pneumoniae ADL-26 | | equivalent name +1308687 | Klebsiella pneumoniae ADL-317 | | scientific name +1308687 | Klebsiella pneumoniae ADL-70 | | equivalent name +1308688 | Klebsiella pneumoniae ADL-322 | | scientific name +1308688 | Klebsiella pneumoniae ADL-75 | | equivalent name +1308731 | Enterobacter aerogenes ADL-323 | | synonym +1308731 | Enterobacter aerogenes ADL-76 | | equivalent name +1308731 | Klebsiella aerogenes ADL-323 | | scientific name +1308858 | Sigmavirus | | scientific name +1309536 | Hydroporus obliquesignatus | | synonym +1309536 | Hydroporus obliquesignatus Bielz, 1852 | | authority +1309536 | Porhydrus obliquesignatus | | scientific name +1309536 | Porhydrus obliquesignatus (Bielz, 1852) | | authority +1310158 | Klebsiella pneumoniae Kb140 | | scientific name +1310159 | Klebsiella pneumoniae Kb677 | | scientific name +1310424 | Verticillium dahliae partitivirus 1 | | scientific name +1315262 | Human papillomavirus type 163 | | equivalent name +1315262 | human papillomavirus 163 | | scientific name +1316582 | Klebsiella pneumoniae ATCC 43816 | | scientific name +1316938 | Klebsiella pneumoniae ATCC 25955 | | scientific name +1316939 | Klebsiella pneumoniae G5-2 | | scientific name +1328324 | Klebsiella pneumoniae subsp. pneumoniae KPNIH27 | | scientific name +1328325 | Klebsiella pneumoniae subsp. pneumoniae KPR0928 | | scientific name +1328337 | Klebsiella pneumoniae BIDMC 31 | | scientific name +1328362 | Klebsiella pneumoniae MGH 17 | | scientific name +1328363 | Klebsiella pneumoniae MGH 18 | | scientific name +1328364 | Klebsiella pneumoniae MGH 19 | | scientific name +1328366 | Klebsiella pneumoniae MGH 21 | | scientific name +1328367 | Klebsiella pneumoniae MGH 29 | | scientific name +1328368 | Klebsiella pneumoniae MGH 30 | | scientific name +1328369 | Klebsiella pneumoniae MGH 31 | | scientific name +1328370 | Klebsiella pneumoniae MGH 32 | | scientific name +1328371 | Klebsiella pneumoniae MGH 35 | | scientific name +1328372 | Klebsiella pneumoniae MGH 36 | | scientific name +1328373 | Klebsiella pneumoniae MGH 39 | | scientific name +1328375 | Klebsiella pneumoniae MGH 43 | | scientific name +1328377 | Klebsiella pneumoniae MGH 45 | | scientific name +1328378 | Klebsiella pneumoniae MGH 46 | | scientific name +1328379 | Klebsiella pneumoniae MGH 47 | | scientific name +1328380 | Klebsiella pneumoniae MGH 48 | | scientific name +1328381 | Klebsiella pneumoniae BWH 2 | | scientific name +1328382 | Klebsiella pneumoniae BWH 15 | | scientific name +1328383 | Klebsiella pneumoniae BWH 22 | | scientific name +1328384 | Klebsiella pneumoniae BWH 28 | | scientific name +1328385 | Klebsiella pneumoniae BWH 30 | | scientific name +1328386 | Klebsiella pneumoniae BWH 36 | | scientific name +1328387 | Klebsiella pneumoniae BWH 41 | | scientific name +1328388 | Klebsiella pneumoniae MGH 78578 | | scientific name +1328389 | Klebsiella pneumoniae UCICRE 1 | | scientific name +1328390 | Klebsiella pneumoniae UCICRE 2 | | scientific name +1328391 | Klebsiella pneumoniae UCICRE 4 | | scientific name +1328392 | Klebsiella pneumoniae UCICRE 6 | | scientific name +1328393 | Klebsiella pneumoniae UCICRE 7 | | scientific name +1328394 | Klebsiella pneumoniae UCICRE 8 | | scientific name +1328396 | Klebsiella pneumoniae UCICRE 13 | | scientific name +1328398 | Klebsiella pneumoniae BIDMC 1 | | scientific name +1328399 | Klebsiella pneumoniae BIDMC 2A | | scientific name +1328400 | Klebsiella pneumoniae BIDMC 4 | | scientific name +1328401 | Klebsiella pneumoniae BIDMC 5 | | scientific name +1328402 | Klebsiella pneumoniae BIDMC 7A | | scientific name +1328403 | Klebsiella pneumoniae BIDMC 7B | | scientific name +1328404 | Klebsiella pneumoniae BIDMC 10 | | scientific name +1328405 | Klebsiella pneumoniae BIDMC 11 | | scientific name +1328406 | Klebsiella pneumoniae BIDMC 12A | | scientific name +1328407 | Klebsiella pneumoniae BIDMC 12B | | scientific name +1328408 | Klebsiella pneumoniae BIDMC 12C | | scientific name +1328409 | Klebsiella pneumoniae BIDMC 13 | | scientific name +1328410 | Klebsiella pneumoniae BIDMC 14 | | scientific name +1328411 | Klebsiella pneumoniae BIDMC 16 | | scientific name +1328412 | Klebsiella pneumoniae BIDMC 18A | | scientific name +1328413 | Klebsiella pneumoniae BIDMC 18B | | scientific name +1328414 | Klebsiella pneumoniae BIDMC 18C | | scientific name +1328415 | Klebsiella pneumoniae BIDMC 18D | | scientific name +1328416 | Klebsiella pneumoniae BIDMC 21 | | scientific name +1328417 | Klebsiella pneumoniae BIDMC 22 | | scientific name +1328418 | Klebsiella pneumoniae BIDMC 23 | | scientific name +1328419 | Klebsiella pneumoniae BIDMC 24 | | scientific name +1328420 | Klebsiella pneumoniae BIDMC 25 | | scientific name +1328421 | Klebsiella pneumoniae BIDMC 32 | | scientific name +1328423 | Klebsiella pneumoniae BIDMC 34 | | scientific name +1328424 | Klebsiella pneumoniae BIDMC 35 | | scientific name +1328425 | Klebsiella pneumoniae BIDMC 36 | | scientific name +1328426 | Klebsiella pneumoniae BIDMC 40 | | scientific name +1328427 | Klebsiella pneumoniae BIDMC 41 | | scientific name +1329649 | Bat bocavirus | | scientific name +1329799 | Archelosauria | | scientific name +1329799 | Archelosauria Crawfort et al. 2014 | | authority +1329799 | Archosauria-Testudines | | synonym +1329799 | Testudines + Archosauria group | | synonym +1329801 | Klebsiella pneumoniae ST272 | | scientific name +1329843 | Klebsiella pneumoniae BIDMC 33B | | scientific name +1331744 | Actinidia virus X | | equivalent name +1331744 | Plantain virus X | | scientific name +1335476 | Eidolon helvum bat papillomavirus 2 | | equivalent name +1335476 | Eidolon helvum bat papillomavirus type 2 | | equivalent name +1335476 | Eidolon helvum papillomavirus 2 | | scientific name +1335476 | Eidolon helvum papillomavirus type 2 | | equivalent name +1335477 | Eidolon helvum bat papillomavirus 3 | | equivalent name +1335477 | Eidolon helvum bat papillomavirus type 3 | | equivalent name +1335477 | Eidolon helvum papillomavirus 3 | | scientific name +1338369 | Dipnotetrapodomorpha | | scientific name +1341693 | Klebsiella pneumoniae subsp. pneumoniae MP14 | | scientific name +1343063 | Klebsiella pneumoniae subsp. pneumoniae UKKV901664 | | scientific name +1343920 | Prunevirus armeniacae | | scientific name +1345628 | Klebsiella pneumoniae SB2390 | | scientific name +1345631 | Klebsiella pneumoniae SB3193 | | scientific name +1348659 | Klebsiella pneumoniae CGMCC 1.1736 | | scientific name +1352932 | Klebsiella pneumoniae LCT-KP182 | | scientific name +1352933 | Klebsiella pneumoniae LCT-KP289 | | scientific name +1357295 | Klebsiella pneumoniae EGD-HP19-C | | scientific name +1365186 | Klebsiella pneumoniae KP-1 | | scientific name +1379687 | Klebsiella pneumoniae BJ1-GA | | synonym +1379687 | Klebsiella pneumoniae subsp. pneumoniae BJ1-GA | | scientific name +1379688 | Klebsiella pneumoniae SA1 | | synonym +1379688 | Klebsiella pneumoniae subsp. pneumoniae SA1 | | scientific name +1379689 | Klebsiella pneumoniae T69 | | synonym +1379689 | Klebsiella pneumoniae subsp. pneumoniae T69 | | scientific name +1380111 | Poecilimon luschani luschani | | scientific name +1380456 | Poecilimon luschani chobanovi | | scientific name +1380456 | Poecilimon luschani chobanovi Boztepe, Kaya & Ciplak, 2013 | | authority +1380456 | Poecilimon luschani ssp. 1 SK-2013 | | includes +1380908 | Klebsiella pneumoniae JM45 | | scientific name +1381121 | Klebsiella pneumoniae 303K | | scientific name +1382995 | Chaetoceros sp. DNA virus 7 | | scientific name +1384549 | Klebsiella pneumoniae subsp. pneumoniae KKBO-1 | | scientific name +1384550 | Klebsiella pneumoniae subsp. pneumoniae KKBO-4 | | scientific name +1385657 | unclassified Gokushovirinae | | scientific name +1387562 | Ophidiomyces | | scientific name +1387562 | Ophidiomyces Sigler, Hambl. & Pare, 2013 | | authority +1387563 | CBS 122913 | CBS 122913 | type material +1387563 | Chrysosporium ophidiicola Guarro, Deanna A. Sutton, Wickes & Rajeev, 2009 | | synonym +1387563 | Chrysosporium sp. R-3923 | | includes +1387563 | Ophidiomyces ophidiicola | | scientific name +1387563 | Ophidiomyces ophidiicola (Guarro, Deanna A. Sutton, Wickes & Rajeev) Sigler, Hambleton & Pare, 2013 | | synonym +1389422 | Klebsiella pneumoniae LAU-KP1 | | scientific name +1392499 | Klebsiella pneumoniae 1158 | | synonym +1392499 | Klebsiella pneumoniae subsp. pneumoniae 1158 | | scientific name +1392500 | Klebsiella pneumoniae HK787 | | scientific name +1393935 | Myotis horsfieldii deignani | | scientific name +1393935 | Myotis horsfieldii deignani Shamel, 1942 | | authority +1393935 | Myotis horsfieldii subsp. deignani | | synonym +1393935 | Myotis horsfieldii subsp. deignani Shamel, 1942 | | authority +1393936 | Myotis horsfieldii horsfieldii | | scientific name +1393936 | Vespertilio horsfieldii horsfieldii | | synonym +1393936 | Vespertilio horsfieldii horsfieldii Temminck, 1840 | | authority +1395574 | Klebsiella pneumoniae subsp. pneumoniae KpQ24 | | scientific name +1395575 | Klebsiella pneumoniae subsp. pneumoniae KpQ15 | | scientific name +1400138 | Enterobacter aerogenes UCI 15 | | synonym +1400138 | Klebsiella aerogenes UCI 15 | | scientific name +1400139 | Enterobacter aerogenes UCI 16 | | synonym +1400139 | Klebsiella aerogenes UCI 16 | | scientific name +1400140 | Enterobacter aerogenes UCI 27 | | synonym +1400140 | Klebsiella aerogenes UCI 27 | | scientific name +1400141 | Enterobacter aerogenes UCI 28 | | synonym +1400141 | Klebsiella aerogenes UCI 28 | | scientific name +1400142 | Enterobacter aerogenes UCI 45 | | synonym +1400142 | Klebsiella aerogenes UCI 45 | | scientific name +1400143 | Enterobacter aerogenes UCI 46 | | synonym +1400143 | Klebsiella aerogenes UCI 46 | | scientific name +1400144 | Enterobacter aerogenes UCI 47 | | synonym +1400144 | Klebsiella aerogenes UCI 47 | | scientific name +1400145 | Enterobacter aerogenes UCI 48 | | synonym +1400145 | Klebsiella aerogenes UCI 48 | | scientific name +1400160 | Klebsiella pneumoniae BIDMC 42a | | scientific name +1400161 | Klebsiella pneumoniae BIDMC 42b | | scientific name +1400162 | Klebsiella pneumoniae BIDMC 45 | | scientific name +1400163 | Klebsiella pneumoniae BIDMC 46a | | scientific name +1400164 | Klebsiella pneumoniae BIDMC 46b | | scientific name +1400165 | Klebsiella pneumoniae BIDMC 47 | | scientific name +1400166 | Klebsiella pneumoniae BIDMC 48 | | scientific name +1400167 | Klebsiella pneumoniae BIDMC 51 | | scientific name +1400168 | Klebsiella pneumoniae BIDMC 52 | | scientific name +1400169 | Klebsiella pneumoniae BIDMC 53 | | scientific name +1400170 | Klebsiella pneumoniae UCI 17 | | scientific name +1400172 | Klebsiella pneumoniae UCI 19 | | scientific name +1400173 | Klebsiella pneumoniae UCI 20 | | scientific name +1400174 | Klebsiella pneumoniae UCI 21 | | scientific name +1400175 | Klebsiella pneumoniae UCI 22 | | scientific name +1400176 | Klebsiella pneumoniae UCI 25 | | scientific name +1400177 | Klebsiella pneumoniae UCI 26 | | scientific name +1400178 | Klebsiella pneumoniae UCI 33 | | scientific name +1400179 | Klebsiella pneumoniae UCI 34 | | scientific name +1400180 | Klebsiella pneumoniae UCI 37 | | scientific name +1400181 | Klebsiella pneumoniae UCI 38 | | scientific name +1400182 | Klebsiella pneumoniae UCI 41 | | scientific name +1400183 | Klebsiella pneumoniae UCI 42 | | scientific name +1400184 | Klebsiella pneumoniae UCI 43 | | scientific name +1400185 | Klebsiella pneumoniae UCI 44 | | scientific name +1401779 | Maiestas | | scientific name +1401779 | Maiestas Distant, 1917 | | authority +1406314 | Klebsiella pneumoniae subsp. pneumoniae PittNDM01 | | scientific name +1409961 | Klebsiella pneumoniae MRSN 1319 | | scientific name +1409962 | Klebsiella pneumoniae MRSN 2404 | | scientific name +1409963 | Klebsiella pneumoniae MRSN 3562 | | scientific name +1409964 | Klebsiella pneumoniae MRSN 3852 | | scientific name +1409965 | Klebsiella pneumoniae MRSN 6902 | | scientific name +1409966 | Klebsiella pneumoniae HE12 | | scientific name +1409966 | Klebsiella pneumoniae MRSN 12230 | | synonym +1411646 | Klebsiella pneumoniae A 860 | | synonym +1411646 | Klebsiella pneumoniae IS10 | | scientific name +1413252 | Klebsiella pneumoniae subsp. pneumoniae KPB-1 | | scientific name +1413253 | Klebsiella pneumoniae subsp. pneumoniae KPB-2 | | scientific name +1414655 | Pepper chlorotic spot virus | | scientific name +1414807 | Pristaulacus compressus | | scientific name +1414807 | Pristaulacus compressus (Spinola, 1808) | | authority +1415246 | Celaenorrhinus maculosa | | scientific name +1415246 | Celaenorrhinus maculosa (Felder & Felder, 1867) | | authority +1415246 | Pterygospidea maculosa | | synonym +1415246 | Pterygospidea maculosa Felder, 1867 | | authority +1416941 | Closterium baillyanum | | scientific name +1416941 | Closterium baillyanum (Brebisson ex Ralfs) Brebisson, 1856 | | authority +1416941 | Closterium didymotocum var. baillyanum | | synonym +1416941 | Closterium didymotocum var. baillyanum Brebisson ex Ralfs, 1848 | | authority +1417983 | Klebsiella pneumoniae subsp. pneumoniae A | | scientific name +1418810 | Mustilizans | | scientific name +1418811 | Mustilia hepatica | | synonym +1418811 | Mustilia hepatica Moore, 1879 | | authority +1418811 | Mustilizans hepatica | | scientific name +1418811 | Mustilizans hepatica Moore, 1879 | | authority +1420012 | Klebsiella pneumoniae 30660/NJST258_1 | | scientific name +1420013 | Klebsiella pneumoniae 30684/NJST258_2 | | scientific name +1424547 | Paspalum pubiflorum | | scientific name +1424547 | Paspalum pubiflorum Rupr. ex E.Fourn., 1886 | | authority +1427476 | Cimodo virus | | scientific name +1427522 | Klebsiella pneumoniae KPM_naseyCln3 | | scientific name +1428763 | TIBOV | | acronym +1428763 | Tibet orbivirus | | scientific name +1431455 | Klebsiella pneumoniae NB60 | | scientific name +1432547 | Klebsiella pneumoniae IS22 | | scientific name +1432550 | Klebsiella pneumoniae IS33 | | scientific name +1432552 | Klebsiella pneumoniae IS43 | | scientific name +1432553 | Klebsiella pneumoniae IS46 | | scientific name +1432554 | Klebsiella pneumoniae IS53 | | scientific name +1432558 | Klebsiella pneumoniae ISC21 | | scientific name +1432561 | Klebsiella pneumoniae IS39 | | scientific name +1432563 | Rottboellia yellow mottle virus | | scientific name +1434070 | Cervus papillomavirus 2 | | scientific name +1434070 | Cervus papillomavirus JSM-2013 | | equivalent name +1434070 | Cervus papillomavirus type 2 | | equivalent name +1435450 | Sclerotinia sclerotiorum umbra-like virus 1 | | scientific name +1436892 | Pea yellow stunt virus | | scientific name +1437010 | Boreoeutheria | | scientific name +1437010 | Boreotheria | | synonym +1437180 | Acrogymnospermae | | scientific name +1437180 | Acrogymnospermae P.D.Cantino & M.J.Donoghue, 2007 | | authority +1437183 | Mesangiospermae | | scientific name +1437183 | Mesangiospermae M.J.Donoghue, J.A.Doyle & P.D.Cantino, 2007 | | authority +1437197 | Petrosaviidae | | scientific name +1437197 | Petrosaviidae S.W.Graham & W.S.Judd, 2007 | | authority +1437201 | Pentapetalae | | scientific name +1437201 | Pentapetalae D.E.Soltis, P.S.Soltis & W.S.Judd, 2007 | | authority +1438697 | Klebsiella pneumoniae BIDMC 54 | | scientific name +1438698 | Klebsiella pneumoniae BIDMC 55 | | scientific name +1438699 | Klebsiella pneumoniae BIDMC 60 | | scientific name +1438701 | Klebsiella pneumoniae BIDMC 68 | | scientific name +1438702 | Klebsiella pneumoniae BIDMC 69 | | scientific name +1438703 | Klebsiella pneumoniae BWH 45 | | scientific name +1438704 | Klebsiella pneumoniae BWH 46 | | scientific name +1438705 | Klebsiella pneumoniae BWH 47 | | scientific name +1438706 | Klebsiella pneumoniae BWH 48 | | scientific name +1438707 | Klebsiella pneumoniae CHS 01 | | scientific name +1438708 | Klebsiella pneumoniae CHS 02 | | scientific name +1438709 | Klebsiella pneumoniae CHS 03 | | scientific name +1438710 | Klebsiella pneumoniae CHS 04 | | scientific name +1438711 | Klebsiella pneumoniae CHS 05 | | scientific name +1438712 | Klebsiella pneumoniae CHS 06 | | scientific name +1438713 | Klebsiella pneumoniae CHS 07 | | scientific name +1438714 | Klebsiella pneumoniae CHS 08 | | scientific name +1438715 | Klebsiella pneumoniae CHS 09 | | scientific name +1438716 | Klebsiella pneumoniae CHS 10 | | scientific name +1438717 | Klebsiella pneumoniae CHS 11 | | scientific name +1438718 | Klebsiella pneumoniae CHS 12 | | scientific name +1438719 | Klebsiella pneumoniae CHS 13 | | scientific name +1438720 | Klebsiella pneumoniae CHS 14 | | scientific name +1438721 | Klebsiella pneumoniae CHS 15 | | scientific name +1438722 | Klebsiella pneumoniae CHS 16 | | scientific name +1438723 | Klebsiella pneumoniae CHS 17 | | scientific name +1438724 | Klebsiella pneumoniae CHS 18 | | scientific name +1438725 | Klebsiella pneumoniae CHS 19 | | scientific name +1438726 | Klebsiella pneumoniae CHS 20 | | scientific name +1438727 | Klebsiella pneumoniae CHS 21 | | scientific name +1438728 | Klebsiella pneumoniae CHS 22 | | scientific name +1438729 | Klebsiella pneumoniae CHS 23 | | scientific name +1438730 | Klebsiella pneumoniae CHS 24 | | scientific name +1438731 | Klebsiella pneumoniae CHS 25 | | scientific name +1438732 | Klebsiella pneumoniae CHS 26 | | scientific name +1438733 | Klebsiella pneumoniae CHS 27 | | scientific name +1438734 | Klebsiella pneumoniae CHS 28 | | scientific name +1438735 | Klebsiella pneumoniae CHS 29 | | scientific name +1438736 | Klebsiella pneumoniae CHS 30 | | scientific name +1438737 | Klebsiella pneumoniae CHS 31 | | scientific name +1438738 | Klebsiella pneumoniae CHS 32 | | scientific name +1438739 | Klebsiella pneumoniae CHS 33 | | scientific name +1438740 | Klebsiella pneumoniae CHS 34 | | scientific name +1438741 | Klebsiella pneumoniae CHS 35 | | scientific name +1438742 | Klebsiella pneumoniae CHS 36 | | scientific name +1438743 | Klebsiella pneumoniae CHS 37 | | scientific name +1438744 | Klebsiella pneumoniae CHS 38 | | scientific name +1438745 | Klebsiella pneumoniae CHS 39 | | scientific name +1438746 | Klebsiella pneumoniae CHS 40 | | scientific name +1438747 | Klebsiella pneumoniae CHS 41 | | scientific name +1438748 | Klebsiella pneumoniae CHS 42 | | scientific name +1438749 | Klebsiella pneumoniae CHS 43 | | scientific name +1438750 | Klebsiella pneumoniae CHS 44 | | scientific name +1438751 | Klebsiella pneumoniae CHS 45 | | scientific name +1438752 | Klebsiella pneumoniae CHS 46 | | scientific name +1438753 | Klebsiella pneumoniae CHS 47 | | scientific name +1438754 | Klebsiella pneumoniae CHS 48 | | scientific name +1438755 | Klebsiella pneumoniae CHS 49 | | scientific name +1438756 | Klebsiella pneumoniae CHS 50 | | scientific name +1438757 | Klebsiella pneumoniae CHS 51 | | scientific name +1438758 | Klebsiella pneumoniae CHS 52 | | scientific name +1438759 | Klebsiella pneumoniae CHS 53 | | scientific name +1438760 | Klebsiella pneumoniae CHS 54 | | scientific name +1438761 | Klebsiella pneumoniae CHS 55 | | scientific name +1438762 | Klebsiella pneumoniae CHS 56 | | scientific name +1438763 | Klebsiella pneumoniae CHS 57 | | scientific name +1438764 | Klebsiella pneumoniae CHS 58 | | scientific name +1438765 | Klebsiella pneumoniae CHS 59 | | scientific name +1438766 | Klebsiella pneumoniae CHS 60 | | scientific name +1438767 | Klebsiella pneumoniae CHS 61 | | scientific name +1438768 | Klebsiella pneumoniae CHS 62 | | scientific name +1438769 | Klebsiella pneumoniae CHS 63 | | scientific name +1438770 | Klebsiella pneumoniae CHS 64 | | scientific name +1438771 | Klebsiella pneumoniae CHS 65 | | scientific name +1438772 | Klebsiella pneumoniae CHS 66 | | scientific name +1438773 | Klebsiella pneumoniae CHS 67 | | scientific name +1438774 | Klebsiella pneumoniae CHS 70 | | scientific name +1438775 | Klebsiella pneumoniae CHS 71 | | scientific name +1438776 | Klebsiella pneumoniae CHS 72 | | scientific name +1438777 | Klebsiella pneumoniae CHS 73 | | scientific name +1438778 | Klebsiella pneumoniae CHS 74 | | scientific name +1438779 | Klebsiella pneumoniae CHS 75 | | scientific name +1438780 | Klebsiella pneumoniae CHS 76 | | scientific name +1438781 | Klebsiella pneumoniae CHS 80 | | scientific name +1438782 | Klebsiella pneumoniae MGH 51 | | scientific name +1438783 | Klebsiella pneumoniae MGH 52 | | scientific name +1438784 | Klebsiella pneumoniae MGH 59 | | scientific name +1438785 | Klebsiella pneumoniae MGH 60 | | scientific name +1438786 | Klebsiella pneumoniae MGH 63 | | scientific name +1438787 | Klebsiella pneumoniae MGH 64 | | scientific name +1438788 | Klebsiella pneumoniae MGH 65 | | scientific name +1438789 | Klebsiella pneumoniae MGH 66 | | scientific name +1438790 | Klebsiella pneumoniae MGH 67 | | scientific name +1438792 | Klebsiella pneumoniae MGH 69 | | scientific name +1438793 | Klebsiella pneumoniae MGH 70 | | scientific name +1438794 | Klebsiella pneumoniae MGH 71 | | scientific name +1438795 | Klebsiella pneumoniae MGH 72 | | scientific name +1438796 | Klebsiella pneumoniae MGH 73 | | scientific name +1438797 | Klebsiella pneumoniae MGH 74 | | scientific name +1438798 | Klebsiella pneumoniae MGH 75 | | scientific name +1438800 | Klebsiella pneumoniae MGH 79 | | scientific name +1438802 | Klebsiella pneumoniae UCI 55 | | scientific name +1438803 | Klebsiella pneumoniae UCI 56 | | scientific name +1438804 | Klebsiella pneumoniae UCI 59 | | scientific name +1438805 | Klebsiella pneumoniae UCI 60 | | scientific name +1438806 | Klebsiella pneumoniae UCI 61 | | scientific name +1438807 | Klebsiella pneumoniae UCI 62 | | scientific name +1438808 | Klebsiella pneumoniae UCI 63 | | scientific name +1438809 | Klebsiella pneumoniae UCI 64 | | scientific name +1438810 | Klebsiella pneumoniae UCI 67 | | scientific name +1438811 | Klebsiella pneumoniae UCI 68 | | scientific name +1439320 | Enterobacter aerogenes MGH 61 | | synonym +1439320 | Klebsiella aerogenes MGH 61 | | scientific name +1439321 | Enterobacter aerogenes MGH 62 | | synonym +1439321 | Klebsiella aerogenes MGH 62 | | scientific name +1439322 | Enterobacter aerogenes MGH 77 | | synonym +1439322 | Klebsiella aerogenes MGH 77 | | scientific name +1439323 | Enterobacter aerogenes MGH 78 | | synonym +1439323 | Klebsiella aerogenes MGH 78 | | scientific name +1442610 | Myotis evotis milleri | | scientific name +1442610 | Myotis evotis milleri Elliot, 1903 | | authority +1442610 | Myotis evotis subsp. milleri | | synonym +1442610 | Myotis evotis subsp. milleri Elliot, 1903 | | authority +1442610 | Myotis milleri | | synonym +1445963 | Cycadidae | | scientific name +1445963 | Cycadidae Pax, 1894 | | authority +1446379 | Cupressales | | scientific name +1446379 | Cupressales Link, 1829 | | authority +1449984 | Klebsiella pneumoniae T2-1-1 | | scientific name +1449985 | Klebsiella pneumoniae T2-1-2 | | scientific name +1451263 | Klebsiella pneumoniae JT4 | | scientific name +1451298 | Anatoecus dentatus | | scientific name +1451298 | Anatoecus dentatus (Scopoli, 1763) | | authority +1451298 | Pediculus dentatus | | synonym +1451298 | Pediculus dentatus Scopoli, 1763 | | authority +1452516 | Caprine kobuvirus | | scientific name +1453155 | Histia flabellicorn | | synonym +1453155 | Histia flabellicornis ultima | | synonym +1453155 | Histia rhodope | | scientific name +1453155 | Histia rhodope (Cramer, 1775) | | authority +1453426 | Klebsiella pneumoniae ST514 | | scientific name +1454021 | Dragonfly larvae associated circular virus-1 | | scientific name +1454022 | Dragonfly larvae associated circular virus-10 | | scientific name +1454022 | Dragonfly larvae associated virus 10 | | equivalent name +1454023 | Dragonfly larvae associated circular virus-2 | | scientific name +1454024 | Dragonfly larvae associated circular virus-3 | | scientific name +1454024 | Dragonfly larvae associated virus 3 | | equivalent name +1454025 | Dragonfly larvae associated circular virus-4 | | scientific name +1454026 | Dragonfly larvae associated circular virus-5 | | scientific name +1454026 | Dragonfly larvae associated virus 5 | | equivalent name +1454027 | Dragonfly larvae associated circular virus-6 | | scientific name +1454027 | Dragonfly larvae associated virus 6 | | equivalent name +1454028 | Dragonfly larvae associated circular virus-7 | | scientific name +1454029 | Dragonfly larvae associated circular virus-8 | | scientific name +1454029 | Dragonfly larvae associated virus 8 | | equivalent name +1454030 | Dragonfly larvae associated circular virus-9 | | scientific name +1454227 | Ageratum yellow vein China alphasatellite | | scientific name +1455602 | Klebsiella pneumoniae 4006 | | scientific name +1455603 | Klebsiella pneumoniae 4541-2 | | scientific name +1455604 | Klebsiella pneumoniae 11227-1 | | scientific name +1455605 | Klebsiella pneumoniae 7699 | | scientific name +1457165 | Wallerfield virus | | scientific name +1457322 | Arrabida virus | | scientific name +1457503 | Dahlstedtia araripensis | | scientific name +1457503 | Dahlstedtia araripensis (Benth.) M.J.Silva & A.M.G.Azevedo, 2012 | | authority +1457503 | Lonchocarpus araripensis | | synonym +1457503 | Lonchocarpus araripensis Benth., 1860 | | authority +1458186 | Alphasatellites | | equivalent name +1458186 | Alphasatellitidae | | scientific name +1460422 | Klebsiella pneumoniae subsp. pneumoniae ST258 | | scientific name +1461176 | Podophylloideae | | scientific name +1461176 | Podophylloideae Eaton, 1836 | | authority +1462681 | Pepo aphid-borne yellows virus | | scientific name +1462682 | Luffa aphid-borne yellows virus | | scientific name +1462708 | Luffa acutangula var. amara | | scientific name +1462708 | Luffa acutangula var. amara (Roxb.) C.B.Clarke, 1879 | | authority +1462708 | Luffa amara | | synonym +1462708 | Luffa amara Roxb., 1832 | | authority +1462709 | Luffa acutangula var. forskalii | | scientific name +1462709 | Luffa acutangula var. forskalii (Schweinf. ex Harms) Heiser & E.E.Schill., 1990 | | authority +1462709 | Luffa forskaolii | | synonym +1462709 | Luffa forskaolii Schweinf. ex Harms, 1923 | | authority +1463138 | Ranunculoideae | | scientific name +1463138 | Ranunculoideae Arn., 1832 | | authority +1463140 | Delphinieae | | scientific name +1463140 | Delphinieae Schroed., 1909 | | authority +1463147 | Anemoneae | | scientific name +1463147 | Anemoneae DC., 1817 | | authority +1463675 | Centropus bengalensis | | scientific name +1463675 | Centropus bengalensis (Gmelin, 1788) | | authority +1463675 | Cuculus bengalensis | | synonym +1463675 | Cuculus bengalensis Gmelin, 1788 | | authority +1463675 | lesser coucal | | genbank common name +1471299 | Grapevine Roditis leaf discoloration-associated virus | | scientific name +1471299 | Grapevine roditis leaf discoloration virus | | equivalent name +1476584 | Currant latent virus | | scientific name +1481465 | Tomato necrotic dwarf virus | | scientific name +1484106 | Anemone japonica var. tomentosa | | synonym +1484106 | Anemone japonica var. tomentosa Maxim., 1889 | | authority +1484106 | Anemone tomentosa | | scientific name +1484106 | Anemone tomentosa (Maxim.) C.Pei, 1933 | | authority +1489341 | Osteoglossocephalai | | scientific name +1489388 | Euteleosteomorpha | | scientific name +1489872 | Percomorpha | | includes +1489872 | Percomorphaceae | | scientific name +1489875 | Gobiaria | | scientific name +1489875 | Gobiomorpharia | | synonym +1489878 | Gobiiformes | | scientific name +1489878 | gobies and sleepers | | genbank common name +1489885 | Pelagiaria | | scientific name +1489885 | Pelagimorpharia | | synonym +1489885 | Stromateoidei | | synonym +1489894 | Scombriformes | | scientific name +1489894 | Scombroidei | | synonym +1489894 | tunas and others | | genbank common name +1489904 | Carangaria | | scientific name +1489904 | Carangimorpha | | synonym +1489904 | Carangimorphariae | | synonym +1489908 | Ovalentaria | | scientific name +1489908 | Stiassnyiformes | | synonym +1489910 | Cichlomorphae | | scientific name +1489911 | Cichliformes | | scientific name +1489911 | Pholidichthyiformes | | in-part +1489911 | cichlids and convict blennies | | genbank common name +1489922 | Eupercaria | | scientific name +1489922 | Percomorpharia | | synonym +1489943 | Serranoidei | | scientific name +1497848 | Papaya meleira virus | | scientific name +1503289 | BtMr-AlphaCoV/SAX2011 | | scientific name +1503291 | BtNv-AlphaCoV/SC2013 | | scientific name +1503292 | BtRf-AlphaCoV/HuB2013 | | scientific name +1503293 | BtRf-AlphaCoV/YN2012 | | scientific name +1503305 | Buddleja albiflora | | scientific name +1503305 | Buddleja albiflora Hemsl., 1889 | | authority +1504569 | Fox fecal rhabdovirus | | scientific name +1504732 | Hollyhock yellow vein mosaic Islamabad virus | | scientific name +1505891 | Epinephelini | | scientific name +1506574 | Parvovirus | | equivalent name +1506574 | Parvoviruses | | equivalent name +1506574 | Protoparvovirus | | scientific name +1507401 | Bocaparvovirus | | scientific name +1507401 | Bocavirus | | equivalent name +1507402 | unclassified Bocaparvovirus | | scientific name +1507402 | unclassified Bocavirus | | equivalent name +1507725 | Chilli leaf curl India alphasatellite | | scientific name +1510155 | FaHV-1 | | acronym +1510155 | Falconid herpesvirus 1 | | scientific name +1511771 | Avisivirus | | scientific name +1511775 | Gallivirus | | scientific name +1511778 | Mischivirus | | scientific name +1511779 | Mischivirus A | | scientific name +1511782 | Pasivirus | | scientific name +1511783 | Pasivirus A | | scientific name +1511784 | Pasivirus A1 | | scientific name +1511784 | Swine parecho sister-clade virus 1 | | equivalent name +1511784 | Swine pasivirus 1 | | equivalent name +1511804 | Rosavirus | | scientific name +1511809 | Betacryptovirus | | equivalent name +1511809 | Betapartitivirus | | scientific name +1511809 | Cryptovirus | | equivalent name +1511809 | Partitivirus | Partitivirus | in-part +1511809 | White clover cryptic virus 2 group | | equivalent name +1511810 | Alphacryptovirus | Alphacryptovirus | in-part +1511810 | Deltapartitivirus | | scientific name +1511860 | Amalgaviridae | | scientific name +1511911 | Tetraparvovirus | | scientific name +1513238 | Dyokappapapillomavirus | | scientific name +1513243 | Dyopipapillomavirus | | scientific name +1513244 | Dyorhopapillomavirus | | scientific name +1513246 | Dyoxipapillomavirus | | scientific name +1513252 | Dyopipapillomavirus 1 | | scientific name +1513253 | Dyorhopapillomavirus 1 | | scientific name +1513256 | Gammapapillomavirus 11 | | scientific name +1513256 | Human papillomavirus 126-like viruses | | equivalent name +1513260 | Gammapapillomavirus 15 | | scientific name +1513261 | Gammapapillomavirus 16 | | scientific name +1513262 | Gammapapillomavirus 17 | | scientific name +1513263 | Gammapapillomavirus 18 | | scientific name +1513265 | Gammapapillomavirus 20 | | scientific name +1513273 | Xipapillomavirus 2 | | scientific name +1513275 | Upsilonpapillomavirus 3 | | scientific name +1513294 | Nyamiviridae | | scientific name +1513308 | Velarivirus | | scientific name +1520881 | OSLEUM clade | | scientific name +1529392 | Caprine parainfluenza virus 3 | | scientific name +1534549 | unclassified Gallivirus | | scientific name +1535266 | Sida yellow vein mosaic alphasatellite | | scientific name +1537102 | Babesia equi WA | | synonym +1537102 | Babesia equi strain WA | | synonym +1537102 | Theileria equi strain WA | | scientific name +1537975 | Kumasi rhabdovirus | | scientific name +1538075 | Malasseziomycetes | | scientific name +1538075 | Malasseziomycetes Denchev & T. Denchev, 2014 | | authority +1542665 | Mesta yellow vein mosaic virus alphasatellite | | scientific name +1542744 | Gemycircularvirus | | scientific name +1542744 | Gemycircularvirus group | | equivalent name +1548713 | Orthobornavirus alphapsittaciforme | | scientific name +1548713 | Psittaciform 1 bornavirus | | equivalent name +1548713 | Psittaciform 1 orthobornavirus | | equivalent name +1548718 | PaBV-4 | | acronym +1548718 | Parrot bornavirus 4 | | scientific name +1548720 | Orthobornavirus serini | | scientific name +1548720 | Passeriform 1 bornavirus | | equivalent name +1548720 | Passeriform 1 orthobornavirus | | equivalent name +1548722 | Orthobornavirus avisaquaticae | | scientific name +1548722 | Waterbird 1 bornavirus | | equivalent name +1548722 | Waterbird 1 orthobornavirus | | equivalent name +1549198 | Conurus rupicola rupicola | | synonym +1549198 | Conurus rupicola rupicola Tschudi, 1844 | | authority +1549198 | Pyrrhura rupicola rupicola | | scientific name +1549198 | Pyrrhura rupicola rupicola (Tschudi, 1844) | | authority +1549675 | Galloanserae | | scientific name +1549675 | Galloanseri | | synonym +1549675 | ducks, geese, chickens, fowl, quail, currasows and allies | | common name +1549864 | TiLV | | acronym +1549864 | Tilapia lake virus | | scientific name +1550518 | Koolpinyah virus | | scientific name +1554466 | Aegosoma | | scientific name +1562068 | Norway rat rosavirus | | scientific name +1563660 | Sucra jujuba nucleopolyhedrovirus | | scientific name +1563660 | Sucra jujube nucleopolyhedrovirus | | equivalent name +1565088 | Colletotrichum higginsianum non-segmented dsRNA virus 1 | | scientific name +1566705 | Aphalaridae | | scientific name +1566718 | Lanthanaphalara | | scientific name +1567544 | CBS 144400 | CBS 144400 | type material +1567544 | CBS-144400 | CBS-144400 | type material +1567544 | CBS144400 | CBS144400 | type material +1567544 | CBS:144400 | CBS:144400 | type material +1567544 | Fusarium sp. ML-2014i | | includes +1567544 | Fusarium tjaetaba | | scientific name +1567544 | Fusarium tjaetaba T.T.H. Vu, J.L. Walsh, M.H. Laurence, L.W. Burgess, E.C.Y. Liew & Summerell, 2016 | | authority +1567544 | NRRL 66243 | NRRL 66243 | type material +1567544 | NRRL-66243 | NRRL-66243 | type material +1567544 | NRRL66243 | NRRL66243 | type material +1567544 | NRRL:66243 | NRRL:66243 | type material +1567544 | RBG 5361 | RBG 5361 | type material +1567544 | RBG-5361 | RBG-5361 | type material +1567544 | RBG5361 | RBG5361 | type material +1567544 | RBG:5361 | RBG:5361 | type material +1569052 | Elderberry carlavirus A | | scientific name +1569053 | Elderberry carlavirus B | | scientific name +1569054 | Elderberry carlavirus C | | scientific name +1569055 | Elderberry carlavirus D | | scientific name +1569056 | Elderberry carlavirus E | | scientific name +1569258 | Walkabout Creek virus | | scientific name +1573459 | Rosellinia necatrix partitivirus 6 | | scientific name +1577137 | Suffolk virus | | scientific name +1585420 | Liviidae | | scientific name +1592764 | Cyclovirus TsCyV-1_JP-NUBS-2014 | | scientific name +1602124 | Cymbidium chlorotic mosaic virus | | scientific name +1603563 | Human astrovirus 3a | | scientific name +1603564 | Human astrovirus 1b | | scientific name +1604871 | Yak enterovirus | | scientific name +1604875 | OraPyV-Pi | | acronym +1604875 | Sumatran orang-utan polyomavirus | | scientific name +1606764 | unclassified Aphthovirus | | scientific name +1606765 | Bovine rhinovirus 1 | | scientific name +1608041 | Bole Tick Virus 2 | | scientific name +1608042 | Bole Tick Virus 3 | | scientific name +1608044 | Changping Tick Virus 2 | | scientific name +1608045 | Changping Tick Virus 3 | | scientific name +1608047 | Huangpi Tick Virus 1 | | scientific name +1608048 | Huangpi Tick Virus 2 | | scientific name +1608049 | Huangpi Tick Virus 3 | | scientific name +1608058 | Lishi Spider Virus 2 | | scientific name +1608060 | Sanxia Water Strider Virus 1 | | scientific name +1608063 | Sanxia water strider virus 4 | | scientific name +1608063 | SxWSV-4 | | acronym +1608064 | Sanxia Water Strider Virus 5 | | scientific name +1608065 | Shayang Fly Virus 1 | | scientific name +1608066 | Shayang Fly Virus 2 | | scientific name +1608067 | Shayang Fly Virus 3 | | scientific name +1608068 | Shayang Spider Virus 1 | | scientific name +1608072 | Shuangao Bedbug Virus 2 | | scientific name +1608075 | Shuangao Insect Virus 1 | | scientific name +1608083 | Tacheng Tick Virus 1 | | scientific name +1608085 | Tacheng Tick Virus 3 | | scientific name +1608086 | Tacheng Tick Virus 4 | | scientific name +1608087 | Tacheng Tick Virus 5 | | scientific name +1608088 | Tacheng Tick Virus 6 | | scientific name +1608088 | TcTV-6 | | acronym +1608089 | Tacheng Tick Virus 7 | | scientific name +1608090 | Taishun Tick Virus | | scientific name +1608091 | Wenzhou Crab Virus 1 | | scientific name +1608093 | Wenzhou Crab Virus 3 | | scientific name +1608094 | Wenzhou Tick Virus | | scientific name +1608095 | Wenzhou Shrimp Virus 1 | | scientific name +1608097 | Wuchang Cockroach Virus 1 | | scientific name +1608100 | Wuhan Ant Virus | | scientific name +1608101 | Wuhan Fly Virus 1 | | scientific name +1608102 | Wuhan Fly Virus 2 | | scientific name +1608104 | Wuhan House Fly Virus 1 | | scientific name +1608105 | Wuhan House Fly Virus 2 | | scientific name +1608107 | Wuhan Insect virus 2 | | scientific name +1608109 | Wuhan Insect virus 4 | | scientific name +1608110 | Wuhan Insect virus 5 | | scientific name +1608111 | Wuhan Insect virus 6 | | scientific name +1608112 | Wuhan Insect virus 7 | | scientific name +1608114 | Wuhan Louse Fly Virus 10 | | scientific name +1608119 | Wuhan Louse Fly Virus 5 | | scientific name +1608123 | Wuhan Louse Fly Virus 9 | | scientific name +1608126 | Wuhan mosquito virus 1 | | scientific name +1608127 | Wuhan Mosquito Virus 2 | | scientific name +1608133 | Wuhan Mosquito Virus 8 | | scientific name +1608134 | Wuhan Mosquito Virus 9 | | scientific name +1608137 | Wuhan Tick Virus 1 | | scientific name +1608138 | Wuhan tick virus 2 | | scientific name +1608139 | Wuhan horsefly Virus | | scientific name +1608141 | Xincheng Mosquito Virus | | scientific name +1608144 | Yichang Insect virus | | scientific name +1608146 | Yongjia Tick Virus 2 | | scientific name +1608533 | Camponotus yamaokai virus | | scientific name +1609290 | Tomato leaf curl Pakistan betasatellite | | scientific name +1609290 | Tomato leaf curl Pakistan virus betasatellite | | equivalent name +1609290 | Tomato leaf curl Pakistan virus satellite DNA beta | | equivalent name +1611877 | Adana virus | | scientific name +1615583 | Vesivirus ferret badger/JX12/China/2012 | | scientific name +1615758 | Tofla virus | | scientific name +1620892 | Inhangapi virus | | scientific name +1622024 | Desmodus rotundus endogenous retrovirus | | scientific name +1628834 | Porcine kobuvirus JS-01-CHN/2013/China | | scientific name +1628834 | Porcine kobuvirus/JS-01-CHN/2013/China | | equivalent name +1629665 | Botrytis cinerea mitovirus 2 | | scientific name +1629666 | Botrytis cinerea mitovirus 3 | | scientific name +1629667 | Botrytis cinerea mitovirus 4 | | scientific name +1629671 | Botrytis cinerea negative-stranded RNA virus 1 | | scientific name +1631554 | Bovine nidovirus TCH5 | | scientific name +1634381 | Sheep polyomavirus 1 | | scientific name +1639119 | Plasmodiidae | | scientific name +1639119 | Plasmodiidae Mesnil, 1903 | | authority +1640277 | Grapevine Cabernet Sauvignon reovirus | | scientific name +1640277 | Grapevine reovirus LV89-15 | | equivalent name +1642018 | Cherax quadricarinatus densovirus | | scientific name +1642515 | Zebra finch circovirus | | scientific name +1646350 | Trichomonas vaginalis virus dsRNA satellite S1 | | scientific name +1647924 | Human papillomavirus KC5 | | scientific name +1648004 | Bambusinae | | scientific name +1648004 | Bambusinae J.Presl, 1830 | | authority +1648008 | Chusqueinae | | scientific name +1648008 | Chusqueinae Soderstr. & R.P.Ellis, 1987 | | authority +1648023 | Parianinae | | scientific name +1648023 | Parianinae Hack., 1887 | | authority +1648033 | Andropogonodae | | scientific name +1648033 | Andropogonodae L.Liu, 1980 | | authority +1648035 | Bambusodae | | scientific name +1648035 | Bambusodae L.Liou, 1980 | | authority +1648036 | Panicodae | | scientific name +1648036 | Panicodae L.Liou, 1980 | | authority +1648037 | Poodae | | scientific name +1648037 | Poodae L.Liu, 1980 | | authority +1648481 | Antarctic picorna-like virus 1 | | scientific name +1648482 | Antarctic picorna-like virus 2 | | scientific name +1648483 | Antarctic picorna-like virus 3 | | scientific name +1648484 | Antarctic picorna-like virus 4 | | scientific name +1652080 | Poeae Chloroplast Group 1 (Aveneae type) | | scientific name +1653394 | Mammarenavirus | | scientific name +1653395 | Reptarenavirus | | scientific name +1654339 | Sclerotinia sclerotiorum botybirnavirus 1 | | scientific name +1654355 | Kilifi Virus | | scientific name +1654357 | La Jolla virus | | scientific name +1654603 | Areca palm velarivirus 1 | | scientific name +1655644 | Parabacteroides distasonis phage YZ-2015a | | equivalent name +1655644 | Parabacteroides phage YZ-2015a | | scientific name +1655645 | Parabacteroides merdae prophage YZ-2015b | | equivalent name +1655645 | Parabacteroides phage YZ-2015b | | scientific name +1655646 | Gokushovirinae Bog1183_53 | | scientific name +1655647 | Microviridae Bog1249_12 | | scientific name +1655648 | Microviridae Bog5275_51 | | scientific name +1655649 | Gokushovirinae Bog5712_52 | | scientific name +1655650 | Gokushovirinae Bog8989_22 | | scientific name +1655651 | Microviridae Bog9017_22 | | scientific name +1655652 | Microviridae Fen2266_11 | | scientific name +1655653 | Microviridae Fen418_41 | | scientific name +1655654 | Microviridae Fen4707_41 | | scientific name +1655655 | Microviridae Fen51_42 | | scientific name +1655656 | Gokushovirinae Fen672_31 | | scientific name +1655657 | Microviridae Fen685_11 | | scientific name +1655658 | Microviridae Fen7786_21 | | scientific name +1655659 | Gokushovirinae Fen7875_21 | | scientific name +1655660 | Microviridae Fen7895_21 | | scientific name +1655661 | Microviridae Fen7918_21 | | scientific name +1655662 | Microviridae Fen7940_21 | | scientific name +1658615 | PBJV | PBJV | acronym +1658615 | Pebjah virus | | scientific name +1659219 | Kobuvirus cattle/Kagoshima-2-24-KoV/2015/JPN | | scientific name +1659220 | Kagovirus 1 | | equivalent name +1659220 | Kobuvirus cattle/Kagoshima-1-22-KoV/2014/JPN | | scientific name +1661062 | Sclerotinia sclerotiorum fusarivirus 1 | | scientific name +1661062 | SsFV1 | | acronym +1661063 | Fusariviridae | | scientific name +1661392 | Victorian trout aquabirnavirus | | scientific name +1661395 | Ampivirus A1 | | scientific name +1661396 | Magnaporthe oryzae virus 3 | | scientific name +1662272 | Dromedary astrovirus | | scientific name +1662272 | Dromedary camel astrovirus | | equivalent name +1662286 | Marbled eel polyomavirus | | scientific name +1662286 | Marbled eel virus | | equivalent name +1662464 | unclassified Megabirnavirus | | scientific name +1663127 | Posavirus 3 | | scientific name +1663197 | Gnathopogon imberbis taeniellus | | synonym +1663197 | Gnathopogon taeniellus | | scientific name +1663197 | Gnathopogon taeniellus (Nichols, 1925) | | authority +1663197 | Leucogobio taeniellus | | synonym +1663197 | Leucogobio taeniellus Nichols, 1925 | | authority +1667384 | PoLVd | | acronym +1667384 | Portulaca latent viroid | | scientific name +1667587 | Papio ursinus cytomegalovirus | | scientific name +1670662 | Bearded dragon parvovirus | | scientific name +1670669 | Lutzomyia reovirus 1 | | scientific name +1670973 | Gyrovirus GyV8 | | scientific name +1670975 | Ustilaginoidea virens unassigned RNA virus HNND-1 | | scientific name +1671382 | Astrovirus Er/SZAL6/HUN/2011 | | scientific name +1675862 | Diatraea saccharalis granulovirus | | scientific name +1675864 | Opsiphanes invirae iflavirus 1 | | scientific name +1675865 | Perigonia lusca single nucleopolyhedrovirus | | scientific name +1675866 | Urbanus proteus nucleopolyhedrovirus | | scientific name +1676181 | Chimpanzee faeces associated microphage 1 | | scientific name +1676183 | Chimpanzee faeces associated microphage 3 | | scientific name +1676267 | Rosellinia necatrix megabirnavirus 2-W8 | | scientific name +1678003 | Chilli leaf curl Ahmedabad virus-India [India/Ahmedabad/2014] | | scientific name +1678042 | Isophya major | | scientific name +1678042 | Isophya major Brunner von Wattenwyl, 1878 | | authority +1678146 | Chirohepevirus eptesici | | scientific name +1678146 | Orthohepevirus D | | equivalent name +1679172 | Chobar Gorge virus | | scientific name +1679238 | Fusarium oxysporum f. sp. dianthi mycovirus 1 | | scientific name +1679933 | Rattus norvegicus polyomavirus 1 | | scientific name +1680130 | unclassified Endornaviridae | | scientific name +1680130 | unclassified Endornavirus | | equivalent name +1681229 | Blastomyces gilchristii | | scientific name +1681229 | Blastomyces gilchristii Eliz.M. Brown, L.R. McTaggart, Sean X. Zhang, D.E. Low, D.A. Stevens & S.E. Richardson, 2013 | | authority +1681229 | CBS 134223 | CBS 134223 | type material +1681229 | PHO TB00018 | PHO TB00018 | type material +1681229 | TB00018 2005 | TB00018 2005 | type material +1682186 | Bee Macula-like virus | | scientific name +1682187 | Varroa Tymo-like virus | | scientific name +1682340 | Human papillomavirus 201 | | scientific name +1682340 | Human papillomavirus type 201 | | equivalent name +1685502 | Pseudogymnoascus destructans partitivirus-pa | | scientific name +1685502 | Pseudogymnoascus destructans virus | | equivalent name +1685755 | Lake Sarah-associated circular virus-28 | | scientific name +1685953 | Macrosiphum euphorbiae virus 1 | | scientific name +1688637 | Lettuce Italian necrotic virus | | scientific name +1690666 | Bombyx mori iflavirus | | scientific name +1690672 | White sucker hepadnavirus | | equivalent name +1690672 | White sucker hepatitis B virus | | scientific name +1692045 | Tobacco virus 1 | | scientific name +1692107 | Fengkai orbivirus | | scientific name +1692242 | Aiptasia sp. sea anemone associated circular virus | | scientific name +1692243 | Artemia melana sponge associated circular genome | | scientific name +1692244 | Calanoida sp. copepod associated circular virus | | scientific name +1692245 | Callinectes ornatus blue crab associated circular virus | | scientific name +1692246 | Callinectes sapidus associated circular virus | | scientific name +1692247 | Didemnum sp. Sea Squirt associated virus | | scientific name +1692248 | Farfantepenaeus duorarum pink shrimp associated circular virus | | scientific name +1692249 | Fiddler Crab associated circular virus | | scientific name +1692250 | Gammarus sp. amphipod associated circular virus | | scientific name +1692251 | Hermit crab associated circular genome | | scientific name +1692252 | Hermit crab associated circular virus | | scientific name +1692253 | Littorina sp. associated circular virus | | scientific name +1692254 | Lytechinus variegatus variable sea urchin associated circular virus | | scientific name +1692255 | Marine snail associated circular virus | | scientific name +1692256 | Mytilus sp. clam associated circular virus | | scientific name +1692257 | Palaemonetes intermedius brackish grass shrimp associated circular virus | | scientific name +1692258 | Palaemonetes kadiakensis Mississippi grass shrimp associated circular virus | | scientific name +1692259 | Palaemonetes sp. common grass shrimp associated circular virus | | scientific name +1692260 | Paramuricea placomus associated circular virus | | scientific name +1692261 | Petrochirus diogenes giant hermit crab associated circular virus | | scientific name +1692262 | Primnoa pacifica coral associated circular virus | | scientific name +1692263 | Sicyonia brevirostris associated circular virus | | scientific name +1699094 | Poecile atricapillus GI tract-associated gemycircularvirus | | scientific name +1701404 | Gokushovirinae GAIR4 | | scientific name +1701405 | Gokushovirinae GNX3R | | scientific name +1705090 | Luffa begomovirus betasatellite | | scientific name +1705091 | Malachra yellow vein mosaic betasatellite | | scientific name +1705092 | Ageratum conyzoides symptomless alphasatellite | | scientific name +1705297 | Ageratum yellow vein virus-Malaysia [Malaysia-Tomato Leaf curl-2011] | | equivalent name +1705297 | Ageratum yellow vein virus-[Malaysia-Tomato Leaf curl-2011] | | scientific name +1705841 | Iodes cirrhosa | | scientific name +1705841 | Iodes cirrhosa Turcz., 1855 | | authority +1708248 | Aster procerus | | scientific name +1708248 | Aster procerus Hemsl., 1888 | | authority +1708572 | Phopivirus | | equivalent name +1708572 | hepatovirus B1 | | scientific name +1708653 | Gemycircularvirus gemy-ch-rat1 | | scientific name +1708712 | Rosellinia necatrix endornavirus 1 | | scientific name +1711684 | HPEV | | acronym +1711684 | Hot pepper alphaendornavirus | | scientific name +1711684 | Hot pepper endornavirus | | equivalent name +1711685 | Atractylodes mild mottle virus | | scientific name +1712570 | Kasokero virus | | scientific name +1712572 | Yogue virus | | scientific name +1714362 | Red clover powdery mildew-associated totivirus 1 | | scientific name +1714363 | Red clover powdery mildew-associated totivirus 2 | | scientific name +1714364 | Red clover powdery mildew-associated totivirus 3 | | scientific name +1714366 | Red clover powdery mildew-associated totivirus 5 | | scientific name +1714367 | Red clover powdery mildew-associated totivirus 6 | | scientific name +1714368 | Red clover powdery mildew-associated totivirus 7 | | scientific name +1714370 | Red clover powdery mildew-associated totivirus 9 | | scientific name +1714570 | Blueberry shoestring virus | | scientific name +1714618 | unclassified Hepatovirus | | scientific name +1715288 | Avian bornavirus C1 | | equivalent name +1715288 | Canary bornavirus 1 | | scientific name +1715288 | CnBV-1 | | acronym +1720595 | Bellflower vein chlorosis virus | | scientific name +1721090 | Tasmanian aquabirnavirus | | scientific name +1723728 | unassigned Polyomaviridae | | equivalent name +1723728 | unclassified Polyomaviridae | | scientific name +1725329 | Potato necrosis virus | | scientific name +1729112 | Passerellidae | | scientific name +1729112 | Passerellidae (Cabanis and Heine 1850) | | authority +1729141 | Human pegivirus 2 | | scientific name +1729670 | Maize associated totivirus 1 | | equivalent name +1729670 | Maize-associated totivirus 1 | | scientific name +1736759 | Chayote yellow mosaic Benin betasatellite | | scientific name +1737345 | Grapevine latent viroid | | scientific name +1737346 | Apple hammerhead viroid-like circular RNA | | scientific name +1737522 | Bank vole polyomavirus | | scientific name +1737523 | Common vole polyomavirus | | scientific name +1738045 | Andrographis yellow vein leaf curl virus | | equivalent name +1738045 | Begomovirus andrographis | | scientific name +1742594 | Melochia mosaic virus | | scientific name +1742595 | Melochia yellow mosaic virus | | scientific name +1742596 | PavYMV | | acronym +1742596 | Pavonia yellow mosaic virus | | scientific name +1743411 | Gorilla anellovirus | | scientific name +1746057 | Beihai barnacle viurs 1 | | scientific name +1746058 | Bole tick virus 4 | | scientific name +1746059 | Gamboa mosquito virus | | scientific name +1746060 | Sanxia water strider virus 6 | | scientific name +1746061 | Shayang fly virus 4 | | scientific name +1746062 | Shayang spider virus 4 | | scientific name +1746063 | Shuangao insect virus 7 | | scientific name +1746064 | Shuangao lacewing virus 2 | | scientific name +1746065 | Tacheng tick virus 8 | | scientific name +1746066 | Wenling shark virus | | scientific name +1746067 | Wuhan aphid virus 1 | | scientific name +1746068 | Wuhan aphid virus 2 | | scientific name +1746069 | Wuhan centipede virus | | scientific name +1746070 | Wuhan cricket virus | | scientific name +1746071 | Wuhan flea virus | | scientific name +1746072 | Xingshan cricket virus | | scientific name +1746073 | Xinzhou spider virus 2 | | scientific name +1746074 | Xinzhou spider virus 3 | | scientific name +1747648 | unclassified Betapartitivirus | | scientific name +1755198 | Parthenium leaf curl alphasatellite | | scientific name +1755467 | Penicillium aurantiogriseum totivirus 1 | | scientific name +1755752 | Penicillium aurantiogriseum fusarivirus 1 | | scientific name +1755785 | Pleospora typhicola fusarivirus 1 | | scientific name +1755792 | Penicillium janczewskii chrysovirus 1 | | scientific name +1756157 | Penicillium aurantiogriseum partitivirus 1 | | scientific name +1756191 | Megabat bufavirus 1 | | scientific name +1756445 | Rattus norvegicus papillomavirus 3 | | scientific name +1756615 | Ustilaginoidea virens RNA virus 5 | | scientific name +1757958 | Hydrobates tethys kelsalli | | synonym +1757958 | Hydrobates tethys kelsalli (Lowe, PR, 1925) | | authority +1757958 | Oceanodroma tethys kelsalli | | scientific name +1757958 | Oceanodroma tethys kelsalli (Lowe, 1925) | | authority +1757958 | Thalassidroma tethys kelsalli | | synonym +1757958 | Thalassidroma tethys kelsalli Lowe, 1925 | | authority +1758139 | CPSbV | | acronym +1758139 | Colombian potato soil-borne virus | | scientific name +1758883 | Imjin River virus 1 | | scientific name +1761477 | Tomato brown rugose fruit virus | | scientific name +1762023 | Pan troglodytes verus polyomavirus 8 | | scientific name +1763507 | Rat bufavirus SY-2015 | | scientific name +1764085 | Toros virus | | scientific name +1764086 | Zerdali virus | | scientific name +1765736 | Nigrospora oryzae victorivirus 1 | | scientific name +1765754 | Camponotus nipponicus virus | | scientific name +1766554 | Swine enteric coronavirus | | scientific name +1766557 | Gallivirus Pf-CHK1/GV | | scientific name +1766559 | Avisivirus Pf-CHK1/AsV | | scientific name +1766828 | Turnip leaf roll virus | | scientific name +1768064 | Tupaia hepatovirus A | | scientific name +1768874 | Sinapis alba cryptic virus 1 | | scientific name +1769780 | Anopheles C virus | | scientific name +1769949 | Rabbit bocaparvovirus | | scientific name +1770265 | Alfalfa dwarfism associated virus | | equivalent name +1770265 | Alfalfa enamovirus 1 | | equivalent name +1770265 | Alfalfa enamovirus-1 | | equivalent name +1770265 | Enamovirus AEV | | scientific name +1770613 | Thelephora terrestris virus 1 | | scientific name +1770617 | unclassified Capillovirus | | scientific name +1770618 | Currant virus A | | scientific name +1774200 | Pepper yellow leaf curl Thailand virus | | scientific name +1774200 | Pepper yellow leaf curl virus-Thailand | | equivalent name +1774276 | Hordeum vulgare alphaendornavirus | | scientific name +1774276 | Hordeum vulgare endornavirus | | equivalent name +1775963 | Jasmine potyvirus T | | equivalent name +1775963 | Jasmine ringspot virus | | equivalent name +1775963 | Jasmine virus T | | scientific name +1776109 | Goose dicistrovirus | | scientific name +1776153 | Diaphorina citri densovirus | | scientific name +1776177 | Cucumis melo alphaendornavirus | | scientific name +1776177 | Cucumis melo endornavirus | | equivalent name +1777015 | Erysiphe cichoracearum alphaendornavirus | | scientific name +1777015 | Erysiphe cichoracearum endornavirus | | equivalent name +1777016 | Panax notoginseng virus A | | scientific name +1778558 | Ctenophore-associated circular virus 1 | | scientific name +1778559 | Ctenophore-associated circular virus 2 | | scientific name +1778560 | Ctenophore-associated circular virus 3 | | scientific name +1778561 | Ctenophore-associated circular virus 4 | | scientific name +1778570 | Ctenophore-associated circular genome 1 | | scientific name +1778571 | Ctenophore-associated circular genome 2 | | scientific name +1778572 | Ctenophore-associated circular genome 3 | | scientific name +1778573 | Ctenophore-associated circular genome 4 | | scientific name +1778580 | Nectarine marafivirus M | | scientific name +1778580 | Nectarine virus M | | equivalent name +1779340 | Phomopsis longicolla RNA virus 1 | | scientific name +1780507 | Myotis gammaherpesvirus 8 | | scientific name +1781241 | Delisea pulchra RNA virus | | scientific name +1788315 | Rat bocavirus | | scientific name +1792583 | Tobacco mosqueado virus | | scientific name +1795648 | Picornavirales Tottori-HG1 | | scientific name +1798085 | Piscine myocarditis-like virus | | scientific name +1802790 | Icacinales | | scientific name +1802790 | Icacinales Tiegh. ex Tiegh., 1993 | | authority +1803898 | Pepper virus A | | scientific name +1804153 | Marine RNA virus PAL128 | | scientific name +1804154 | Marine RNA virus PAL156 | | scientific name +1804156 | Marine RNA virus PAL473 | | scientific name +1804622 | Suaedoideae | | scientific name +1804623 | Chenopodiaceae | | scientific name +1804623 | Chenopodiaceae Vent., 1799 | | authority +1804623 | goosefoot family | | common name +1805494 | Bamaga virus | | scientific name +1809242 | unclassified Flexiviridae | | equivalent name +1809242 | unclassified Tymovirales | | scientific name +1809767 | Ixeridium yellow mottle virus 1 | | scientific name +1811230 | Callinectes sapidus reovirus 1 | | scientific name +1811408 | Privet leaf blotch-associated virus | | scientific name +1812179 | Bovine calicivirus strain Kirklareli | | scientific name +1812308 | Deinbollia mosaic virus | | scientific name +1812308 | East African cassava mosaic-like virus | | equivalent name +1813613 | Picornavirales Bu-3 | | scientific name +1813615 | Picornavirales Bu-1 | | scientific name +1815581 | Grapevine leafroll-associated virus 13 | | scientific name +1816484 | Cronartium ribicola mitovirus 1 | | scientific name +1816485 | Cronartium ribicola mitovirus 2 | | scientific name +1816486 | Cronartium ribicola mitovirus 3 | | scientific name +1816487 | Cronartium ribicola mitovirus 4 | | scientific name +1816488 | Cronartium ribicola mitovirus 5 | | scientific name +1817526 | Ixeridium yellow mottle virus 2 | | scientific name +1819678 | Cucurbit yellow mosaic alphasatellite | | scientific name +1820326 | Avian paramyxovirus 13 goose/Kazakhstan/5751/2013 | | scientific name +1821222 | Culiseta flavivirus | | scientific name +1821227 | Xishuangbanna aedes flavivirus | | scientific name +1822365 | BoRV-CH15 | | acronym +1822365 | Bovine betaretrovirus CH15 | | equivalent name +1822365 | Bovine retrovirus CH15 | | scientific name +1823757 | Kafue kinda chacma baboon virus | | scientific name +1823757 | Kafue kinda x chacma baboon virus | | equivalent name +1825924 | Barley virus G | | scientific name +1825931 | Tomato yellow leaf curl Shuangbai virus - [Y4536] | | scientific name +1826059 | Enterovirus SEV-gx | | scientific name +1826822 | Alternaria arborescens mitovirus 1 | | scientific name +1833824 | Maize yellow dwarf virus-RMV2 | | scientific name +1833938 | Penicillium digitatum virus 1 | | scientific name +1837089 | Rhizoctonia oryzae-sativae mitovirus 1 | | scientific name +1840528 | Sclerotinia sclerotiorum mycoreovirus 4 | | scientific name +1841147 | Bhindi yellow vein alphasatellite | | scientific name +1843734 | Faeces associated gemycircularvirus 14 | | scientific name +1843734 | Faeces associated gemycircularvirus-14 | | equivalent name +1843735 | Faeces associated gemycircularvirus 15 | | scientific name +1843735 | Faeces associated gemycircularvirus-15 | | equivalent name +1843736 | Faeces associated gemycircularvirus 16 | | scientific name +1843736 | Faeces associated gemycircularvirus-16 | | equivalent name +1843737 | Faeces associated gemycircularvirus 17 | | scientific name +1843737 | Faeces associated gemycircularvirus-17 | | equivalent name +1843738 | Faeces associated gemycircularvirus 18 | | scientific name +1843738 | Faeces associated gemycircularvirus-18 | | equivalent name +1843739 | 49 Fec80061 pig | | acronym +1843739 | Faeces associated gemycircularvirus 19 | | scientific name +1843739 | Faeces associated gemycircularvirus-19 | | equivalent name +1843740 | Faeces associated gemycircularvirus 20 | | scientific name +1843740 | Faeces associated gemycircularvirus-20 | | equivalent name +1843742 | Faeces associated gemycircularvirus 22 | | scientific name +1843742 | Faeces associated gemycircularvirus-22 | | equivalent name +1843761 | Faecal-associated gemycircularvirus-23 | | equivalent name +1843761 | Sewage associated gemycircularvirus 3 | | scientific name +1843761 | Sewage associated gemycircularvirus-3 | | equivalent name +1843761 | Sewage-associated gemycircularvirus 3 | | equivalent name +1843761 | Sewage-associated gemycircularvirus-3 | | equivalent name +1843773 | Porcine associated stool circular virus | | equivalent name +1843773 | Porcine stool-associated circular virus | | scientific name +1844928 | Avian-like circovirus | | scientific name +1848040 | Water chestnut soymovirus 1 | | scientific name +1848042 | Fusarium poae dsRNA virus 2 | | scientific name +1848150 | Fusarium poae mitovirus 1 | | scientific name +1848151 | Fusarium poae mitovirus 2 | | scientific name +1848152 | Fusarium poae mitovirus 3 | | scientific name +1848153 | Fusarium poae mitovirus 4 | | scientific name +1848169 | Fusarium poae dsRNA virus 3 | | scientific name +1849328 | Enterovirus goat/JL14 | | scientific name +1849531 | Fusarium poae narnavirus 1 | | scientific name +1849532 | Fusarium poae narnavirus 2 | | scientific name +1849533 | Fusarium poae partitivirus 2 | | scientific name +1849534 | Fusarium poae virus 1-240374 | | scientific name +1849535 | Fusarium poae victorivirus 1 | | scientific name +1849537 | Fusarium poae fusarivirus 1 | | scientific name +1849542 | Fusarium poae mycovirus 1 | | scientific name +1849543 | Fusarium poae mycovirus 2 | | scientific name +1849544 | Fusarium poae negative-stranded virus 1 | | scientific name +1849545 | Fusarium poae negative-stranded virus 2 | | scientific name +1850906 | Catopsilia pomona nucleopolyhedrovirus | | scientific name +1853762 | Jasmine virus C | | scientific name +1853865 | EcmLV | | acronym +1853865 | Euphorbia caput-medusae latent virus | | scientific name +1856030 | Golden shiner totivirus | | scientific name +1856031 | Pecan mosaic-associated virus | | scientific name +1856627 | Phytomonas serpens narnavirus 1 | | scientific name +1856627 | PserNV1 | | acronym +1856642 | Maize yellow mosaic virus | | scientific name +1857323 | Tospovirus kiwifruit/YXW/2014 | | scientific name +1859149 | Torque teno mini virus 18 | | scientific name +1859161 | Sclerotinia nivalis victorivirus 1 | | scientific name +1862127 | Wild onion symptomless virus | | scientific name +1862824 | Gemycircularvirus HV-GcV1 | | scientific name +1862825 | Gemycircularvirus HV-GcV2 | | scientific name +1862978 | Etheostoma fonticola aquareovirus | | scientific name +1864484 | Ungulate bocaparvovirus 6 | | equivalent name +1864484 | bovine bocaparvovirus 2 | | scientific name +1868472 | Yacon virus A | | scientific name +1869931 | Evergestis extimalis | | scientific name +1869931 | Phalaena extimalis | | synonym +1869931 | Phalaena extimalis Scopoli, 1763 | | authority +1871153 | Nylanderia fulva virus 1 | | scientific name +1871631 | Rhizoctonia solani flexivirus 1 | | scientific name +1872710 | Fusarium graminearum deltaflexivirus 1 | | scientific name +1872719 | Botrytis ourmia like virus | | equivalent name +1872719 | Botrytis ourmia-like virus | | scientific name +1873455 | Atypical porcine pestivirus 1 | | scientific name +1874267 | Maize associated totivirus-2 | | equivalent name +1874267 | Maize-associated totivirus 2 | | scientific name +1874267 | Maize-associated totivirus-2 | | equivalent name +1874886 | Ramie mosaic Yunnan virus | | scientific name +1881013 | Senna mosaic virus | | scientific name +1882382 | Sea otter parvovirus 1 | | scientific name +1882732 | Corythaixoides concolor bechuanae | | scientific name +1882732 | Corythaixoides concolor bechuanae Roberts, 1932 | | authority +1884450 | Husa-like virus KS-2016a | | scientific name +1884455 | Anphevirus | | scientific name +1884456 | Arlivirus | | scientific name +1884458 | Crustavirus | | scientific name +1884460 | Anphevirus xinchengense | | scientific name +1884460 | Xincheng anphevirus | | equivalent name +1884461 | Arlivirus arachnae | | scientific name +1884461 | Lishi arlivirus | | equivalent name +1884640 | Bulleribasidiaceae | | scientific name +1884640 | Bulleribasidiaceae X.Z. Liu, F.Y. Bai, M. Groenew. & Boekhout, 2016 | | authority +1884640 | Bulleribasidiaceae Xin Zhan Liu, F.Y. Bai, M. Groenew. & Boekhout, 2015 | | authority +1884832 | Gompholobium virus A | | scientific name +1884917 | ABBV-2 | | acronym +1884917 | Aquatic bird bornavirus 2 | | scientific name +1884917 | Avian bornavirus MALL | | equivalent name +1884991 | Senna leaf curl virus | | scientific name +1885248 | VSBV-1 | | acronym +1885248 | Variegated squirrel bornavirus 1 | | scientific name +1885927 | Sparus aurata polyomavirus 1 | | scientific name +1885928 | Sparus aurata papillomavirus 1 | | scientific name +1886606 | Callistephus mottle virus | | scientific name +1887213 | Bos taurus papillomavirus 13 | | scientific name +1887213 | Bovine papillomavirus type 13 | | synonym +1887214 | Bos taurus papillomavirus 16 | | scientific name +1887215 | Bos taurus papillomavirus 17 | | scientific name +1887216 | Bos taurus papillomavirus 18 | | scientific name +1887217 | Bos taurus papillomavirus 19 | | scientific name +1887218 | Bos taurus papillomavirus 20 | | scientific name +1887219 | Bos taurus papillomavirus 21 | | scientific name +1888309 | Washington bat picornavirus | | scientific name +1888311 | Bat tymo-like virus | | scientific name +1890365 | Coccinia mottle virus | | scientific name +1890423 | Tomato yellow leaf distortion virus - Sidastrum | | scientific name +1891704 | Sophora japonica powdery mildew-associated partitivirus | | scientific name +1891713 | Alphapolyomavirus | | scientific name +1891714 | Betapolyomavirus | | scientific name +1891715 | Deltapolyomavirus | | scientific name +1891741 | Alphapolyomavirus ponabelii | | scientific name +1891741 | Pongo abelii polyomavirus 1 | | equivalent name +1895012 | Plagiorhegma | | scientific name +1895012 | Plagiorhegma Maxim., 1859 | | authority +1897087 | Mammalian 2 bornavirus | | equivalent name +1897087 | Mammalian 2 orthobornavirus | | equivalent name +1897087 | Orthobornavirus sciuri | | scientific name +1897538 | Common bean-associated gemycircularvirus | | scientific name +1897731 | Aichivirus D | | equivalent name +1897731 | Kobuvirus dekago | | scientific name +1899219 | Synedrella leaf curl virus | | scientific name +1899566 | Ligustrum virus A | | scientific name +1902501 | Rosavirus B | | scientific name +1902502 | Rosavirus C | | scientific name +1903340 | Anopheles flavivirus - variant 1 | | equivalent name +1903340 | Anopheles flavivirus variant 1 | | scientific name +1903412 | Hafniaceae | | scientific name +1903412 | Hafniaceae Adeolu et al. 2016 | | authority +1904408 | Miniopterus schreibersii polyomavirus 1 | | scientific name +1904409 | Miniopterus schreibersii polyomavirus 2 | | scientific name +1904410 | Rhinolophus hildebrandtii polyomavirus 1 | | scientific name +1904411 | Rousettus aegyptiacus polyomavirus 1 | | scientific name +1904439 | Simian retrovirus 8 | | scientific name +1904880 | Macroptilium bright mosaic virus | | scientific name +1904881 | Macroptilium common mosaic virus | | scientific name +1904882 | Sida angular mosaic virus | | scientific name +1904883 | Sida chlorotic vein virus | | scientific name +1904884 | Wissadula yellow mosaic virus | | scientific name +1906179 | Anopheles flavivirus Liberia/2013 | | scientific name +1906245 | Moku virus | | scientific name +1906317 | Grapevine geminivirus A | | scientific name +1906668 | Malvastrum bright yellow mosaic virus | | scientific name +1907771 | Parus major densovirus | | scientific name +1908665 | Myotis oxyotus gardneri | | scientific name +1908665 | Myotis oxyotus gardneri LaVal, 1973 | | authority +1908807 | Ceratobasidium endornavirus B | | scientific name +1908808 | Ceratobasidium endornavirus D | | scientific name +1908811 | Ceratobasidium endornavirus G | | scientific name +1908813 | Ceratobasidium endornavirus C | | scientific name +1910928 | Genomoviridae | | scientific name +1910929 | unclassified Gemycircularvirus | | scientific name +1910929 | unclassified Gemycircularvirus group | | equivalent name +1911602 | Pelarspovirus | | scientific name +1912919 | Isoptera | | synonym +1912919 | Termitoidae | | scientific name +1912919 | termites | termites | blast name +1912919 | termites | termites | genbank common name +1913124 | Cowpea polerovirus 1 | | scientific name +1913125 | Cowpea polerovirus 2 | | scientific name +1914295 | Prunevirus | | scientific name +1914297 | Quinvirinae | | scientific name +1914298 | Trivirinae | | scientific name +1914447 | atypical porcine pestivirus | | scientific name +1916095 | Hydrobates tethys tethys | | synonym +1916095 | Hydrobates tethys tethys (Bonaparte, 1852) | | authority +1916095 | Oceanodroma tethys tethys | | scientific name +1916095 | Oceanodroma tethys tethys (Bonaparte, 1852) | | authority +1916236 | Tobamovirus ToBRTm-2 | | equivalent name +1916236 | Tomato brown rugose fruit virus-israeli | | scientific name +1918013 | Botybirnavirus | | scientific name +1918014 | Botrytis porri RNA virus 1 | | equivalent name +1918014 | Botrytis porri botybirnavirus 1 | | scientific name +1922348 | unclassified RNA viruses ShiM-2016 | | scientific name +1922602 | Beihai picorna-like virus 57 | | scientific name +1922604 | Beihai picorna-like virus 59 | | scientific name +1922669 | Beihai shrimp virus 3 | | scientific name +1922934 | Hubei myriapoda virus 5 | | scientific name +1922938 | Hubei myriapoda virus 9 | | scientific name +1923351 | Jingmen tombus-like virus 1 | | scientific name +1923697 | Wuhan cricket virus 2 | | scientific name +1923716 | Wuhan insect virus 12 | | scientific name +1923726 | Wuhan insect virus 22 | | scientific name +1923736 | Wuhan insect virus 33 | | scientific name +1923737 | Wuhan insect virus 34 | | scientific name +1923738 | Wuhan insect virus 35 | | scientific name +1923739 | Wuhan insect virus 8 | | scientific name +1923740 | Wuhan insect virus 9 | | scientific name +1923742 | Wuhan millipede virus 3 | | scientific name +1923743 | Wuhan nido-like virus 1 | | scientific name +1923745 | Wuhan pillworm virus 2 | | scientific name +1923746 | Wuhan pillworm virus 3 | | scientific name +1923748 | Wuhan poty-like virus 1 | | scientific name +1923752 | Wuhan spider virus 3 | | scientific name +1923753 | Wuhan spider virus 4 | | scientific name +1923754 | Wuhan spider virus 5 | | scientific name +1923755 | Wuhan spider virus 6 | | scientific name +1923756 | Wuhan spider virus 7 | | scientific name +1923757 | Wuhan spider virus 8 | | scientific name +1923758 | Wuhan spider virus 9 | | scientific name +1923759 | Wuhan spirurian nematodes virus 1 | | scientific name +1923761 | Xingshan nematode virus 2 | | scientific name +1923763 | Xingshan nematode virus 4 | | scientific name +1923764 | Xingshan nematode virus 5 | | scientific name +1923765 | Xingshan nematode virus 6 | | scientific name +1923768 | Xinzhou dimarhabdovirus virus 1 | | scientific name +1923769 | Xinzhou nematode virus 1 | | scientific name +1923770 | Xinzhou nematode virus 2 | | scientific name +1923771 | Xinzhou nematode virus 3 | | scientific name +1923772 | Xinzhou nematode virus 4 | | scientific name +1923773 | Xinzhou nematode virus 5 | | scientific name +1923775 | Xinzhou nematode virus 7 | | scientific name +1923777 | Xinzhou toro-like virus | | scientific name +1923778 | Zhejiang mosquito virus 1 | | scientific name +1923781 | Ubei picorna-like virus 3 | | scientific name +1928073 | Maiestas dorsalis | | scientific name +1928073 | Maiestas dorsalis (Motschulsky, 1859) | | authority +1929150 | Enterovirus AN12 | | scientific name +1930602 | Psocodea | | scientific name +1930602 | Psocodea Hennig, 1966 | | authority +1930602 | Psocoptera | | synonym +1930602 | booklice, barklice & lice | booklice, barklice & lice | blast name +1930602 | booklice, barklice & lice | booklice, barklice & lice | genbank common name +1931113 | Pea leaf distortion betasatellite | | scientific name +1936269 | Helicoverpa armigera iflavirus | | scientific name +1938656 | Jingmen tombus-like virus 2 | | scientific name +1940252 | Cacao mild mosaic virus | | scientific name +1940555 | Murine roseolovirus | | scientific name +1941233 | Thrips-associated gemycircularvirus 1 | | equivalent name +1941233 | Thrips-associated genomovirus 1 | | scientific name +1941234 | Thrips-associated gemycircularvirus 2 | | equivalent name +1941234 | Thrips-associated genomovirus 2 | | scientific name +1941235 | unclassified Genomoviridae | | scientific name +1941236 | Gemykibivirus | | scientific name +1941237 | Thrips-associated gemykibivirus 1 | | equivalent name +1941237 | Thrips-associated genomovirus 3 | | scientific name +1941238 | Gemykolovirus | | scientific name +1941239 | Thrips-associated gemykolovirus 1 | | equivalent name +1941239 | Thrips-associated genomovirus 4 | | scientific name +1941435 | Amphibola crenata associated bacilladnavirus 1 | | scientific name +1941436 | Amphibola crenata associated bacilladnavirus 2 | | scientific name +1941437 | Avon-Heathcote estuary associated bacilladnavirus | | scientific name +1950126 | Clematis chlorotic mottle virus | | scientific name +1955054 | Tomato leaf curl Burkina Faso virus | | scientific name +1955247 | Auchenorrhyncha | | scientific name +1955493 | Orbivirus SX-2017a | | scientific name +1955730 | Peach virus D | | scientific name +1958777 | Bat sapelovirus | | scientific name +1958778 | Bat iflavirus | | scientific name +1958784 | Bat dicibavirus | | scientific name +1958957 | Cassava satellite virus | | scientific name +1959930 | Bat sapovirus | | scientific name +1961665 | Qinghai Himalayan marmot astrovirus 1 | | scientific name +1961665 | Qinghai Himalayana marmot AstV1 | | equivalent name +1961666 | Qinghai Himalayan marmot astrovirus 2 | | scientific name +1961666 | Qinghai Himalayana marmot AstV 2 | | equivalent name +1961785 | Rhopapillomavirus 2 | | scientific name +1961833 | Ceuthmochares | | scientific name +1961834 | Ceuthmochares aereus | | scientific name +1961834 | Ceuthmochares aereus (Vieillot, 1817) | | authority +1961834 | Cuculus aereus | | synonym +1961834 | Cuculus aereus Vieillot, 1817 | | authority +1963758 | Myomorpha | | scientific name +1963758 | Sciurognathi | Sciurognathi | in-part +1963758 | mice and others | | genbank common name +1964372 | Circovirus sp. | | scientific name +1965238 | Pityohyphantes rubrofasciatus iflavirus | | scientific name +1965306 | Lagenaria siceraria endornavirus-Hubei | | scientific name +1965344 | LI polyomavirus | | scientific name +1967841 | Tomato yellow mottle-associated virus | | scientific name +1970065 | Alpaca polyomavirus | | scientific name +1972572 | Cocal vesiculovirus | | equivalent name +1972572 | Vesiculovirus cocal | | scientific name +1972589 | Adelaide River ephemerovirus | | equivalent name +1972589 | Ephemerovirus adelaide | | scientific name +1972596 | Ephemerovirus koolpinyah | | scientific name +1972596 | Koolpinyah ephemerovirus | | equivalent name +1972597 | Ephemerovirus yata | | scientific name +1972597 | Yata ephemerovirus | | equivalent name +1972700 | Diamondback moth iflavirus | | scientific name +1972716 | Arracacha virus V | | scientific name +1972995 | Tobacco virus 2 | | scientific name +1973265 | WBV1 | | acronym +1973265 | Wisteria badnavirus 1 | | scientific name +1977105 | Crustavirus wenzhouense | | scientific name +1977105 | Wenzhou crustavirus | | equivalent name +1977392 | Cassava virus X | | scientific name +1978413 | Watermelon betaflexivirus 1 | | equivalent name +1978413 | Watermelon virus A | | scientific name +1978532 | Ledantevirus | | scientific name +1978539 | Ledantevirus yongjia | | scientific name +1978539 | Yongjia ledantevirus | | equivalent name +1978541 | Ledantevirus wuhan | | scientific name +1978541 | Wuhan ledantevirus | | equivalent name +1978543 | Kumasi ledantevirus | | equivalent name +1978543 | Ledantevirus kumasi | | scientific name +1978920 | Raccoon-associated polyomavirus 2 | | scientific name +1980412 | Fimoviridae | | scientific name +1980415 | Nairoviridae | | scientific name +1980416 | Bunyaviridae | | equivalent name +1980416 | Peribunyaviridae | | scientific name +1980417 | Feraviridae | | includes +1980417 | Jonviridae | | includes +1980417 | Phasmaviridae | | scientific name +1980418 | Phenuiviridae | | scientific name +1980419 | Tospoviridae | | scientific name +1980420 | Goukovirus | | scientific name +1980421 | Phasivirus | | scientific name +1980427 | Emaravirus fici | | scientific name +1980427 | Fig mosaic emaravirus | | equivalent name +1980427 | Fig mosaic virus | | equivalent name +1980428 | Emaravirus tritici | | scientific name +1980428 | High Plains wheat mosaic emaravirus | | equivalent name +1980428 | High Plains wheat mosaic virus | | equivalent name +1980429 | Emaravirus cajani | | scientific name +1980429 | Pigeonpea sterility mosaic emaravirus 1 | | equivalent name +1980429 | Pigeonpea sterility mosaic virus 1 | | equivalent name +1980429 | Pigeonpea sterility mosaic virus-I | | equivalent name +1980429 | Pigeonpea sterlity mosaic virus-I | | equivalent name +1980430 | Emaravirus toordali | | scientific name +1980430 | Pigeonpea sterility mosaic emaravirus 2 | | equivalent name +1980430 | Pigeonpea sterility mosaic virus 2 | | equivalent name +1980430 | Pigeonpea sterility mosaic virus II | | equivalent name +1980430 | Pigeonpea sterility mosaic virus-II | | equivalent name +1980430 | Pigeonpea sterlity mosaic virus-II | | equivalent name +1980431 | Emaravirus idaeobati | | scientific name +1980431 | Raspberry leaf blotch emaravirus | | equivalent name +1980431 | Raspberry leaf blotch virus | | equivalent name +1980517 | Nairovirus | | equivalent name +1980517 | Nairoviruses | | equivalent name +1980517 | Orthonairovirus | | scientific name +1980538 | Orthophasmavirus | | scientific name +1985366 | Gemygorvirus | | scientific name +1985372 | bovine associated gemycircularvirus 1 | | scientific name +1985375 | Chickadee associated gemycircularvirus 1 | | scientific name +1985376 | Chicken associated gemycircularvirus 1 | | scientific name +1985377 | Chicken associated gemycircularvirus 2 | | scientific name +1985379 | Equine associated gemycircularvirus 1 | | scientific name +1985392 | Poaceae associated gemycircularvirus 1 | | scientific name +1985392 | Poaceae-associated gemycircularvirus 1 | | equivalent name +1985392 | Poaceae-associated gemycircularvirus-1 | | equivalent name +1985393 | Porcine associated gemycircularvirus 1 | | scientific name +1985405 | Rat associated gemycircularvirus 1 | | scientific name +1985412 | sheep associated gemycircularvirus 1 | | scientific name +1985425 | Canine associated gemygorvirus 1 | | scientific name +1985426 | Mallard associated gemygorvirus 1 | | scientific name +1985699 | Barley yellow striate mosaic cytorhabdovirus | | equivalent name +1985699 | Barley yellow striate mosaic virus | | equivalent name +1985699 | Cytorhabdovirus hordei | | scientific name +1986112 | Bovine nidovirus 1 | | scientific name +1986190 | Alfalfa enamovirus 2 | | scientific name +1986960 | Ampivirus A | | equivalent name +1986960 | Ampivirus apilisi | | scientific name +1986961 | Ampivirus | | scientific name +1987123 | Hepatovirus B | | scientific name +1987125 | Hepatovirus D | | scientific name +1987129 | Hepatovirus H | | scientific name +1987130 | Hepatovirus I | | scientific name +1987140 | Rodent hepatovirus RMU101637Micarv2010 | | scientific name +1987140 | Rodent hepatovirus [RMU101637Micarv2010] | | equivalent name +1987144 | Hedgehog hepatovirus Igel8Erieur2014 | | scientific name +1987144 | Hedgehog hepatovirus [Igel8Erieur2014] | | equivalent name +1987145 | Shrew hepatovirus KS121232Sorara2012 | | scientific name +1987145 | Shrew hepatovirus [KS121232Sorara2012] | | equivalent name +1987744 | Squirrel associated cyclovirus 1 | | scientific name +1993640 | Tolecusatellitidae | | scientific name +2003309 | Bat associated circovirus 4 | | scientific name +2003309 | Tadarida brasiliensis circovirus 1 | | equivalent name +2003394 | Alphaendornavirus | | scientific name +2003394 | Endornavirus | | equivalent name +2003395 | Betaendornavirus | | scientific name +2004962 | Human associated gemykibivirus 5 | | scientific name +2005033 | Anoeconeossa | | scientific name +2006147 | Myodes glareolus polyomavirus 1 | | scientific name +2006148 | Microtus arvalis polyomavirus 1 | | scientific name +2006158 | Betapolyomavirus octipanos | | scientific name +2006158 | Pan troglodytes polyomavirus 8 | | equivalent name +2010320 | French bean leaf curl betasatellite | | scientific name +2010321 | Momordica yellow mosaic betasatellite | | scientific name +2018325 | Tettigoniidea | | scientific name +2020310 | Aegosoma sinicum | | scientific name +2020310 | Aegosoma sinicum White, 1853 | | authority +2021209 | Human astrovirus 4c | | scientific name +2022639 | Solinviviridae | | scientific name +2022641 | Nyfulvavirus | | scientific name +2022857 | Capulavirus | | scientific name +2022857 | Capulaviruses | | equivalent name +2029065 | Hemerobiiformia | | scientific name +2034996 | Tilapia tilapinevirus | | equivalent name +2034996 | Tilapinevirus tilapiae | | scientific name +2034997 | Tilapinevirus | | scientific name +2038729 | Black medic leaf roll virus | | scientific name +2038729 | Black medic leafroll virus | | equivalent name +2039307 | Cirsium japonicum var. spinossimum | | scientific name +2039307 | Cirsium japonicum var. spinossimum (Kitam.) Kitam., 1944 | | authority +2039307 | Cirsium maackii var. spinossimum | | synonym +2039307 | Cirsium maackii var. spinossimum Kitam., 1937 | | authority +2045258 | Nemaliophycidae | | scientific name +2045261 | Rhodymeniophycidae | | scientific name +2047826 | Calophya californica | | scientific name +2047826 | Calophya californica Schwarz, 1904 | | authority +2048238 | Tetraonchoididae | | scientific name +2048239 | Paratetraonchoides | | scientific name +2048240 | Paratetraonchoides inermis | | scientific name +2048240 | Paratetraonchoides inermis Bychowsky, Gussev & Nagibina, 1965 | | authority +2050584 | French bean leaf curl virus | | scientific name +2065824 | Sineleotris | | scientific name +2065826 | Sineleotris saccharae | | scientific name +2065826 | Sineleotris saccharae Herre, 1940 | | authority +2072024 | Mocis latipes granulovirus | | scientific name +2072716 | Spiruromorpha | | scientific name +2080833 | unclassified Avisivirus | | scientific name +2136291 | Obrimoposthia wandeli | | scientific name +2136291 | Obrimoposthia wandeli (Hallez, 1906) | | authority +2169561 | Ortervirales | | scientific name +2169567 | Bacilladnaviridae | | scientific name +2169568 | Deltaflexiviridae | | scientific name +2169569 | Deltaflexivirus | | scientific name +2169574 | Smacoviridae | | scientific name +2169577 | Solemoviridae | | scientific name +2169595 | Firstpapillomavirinae | | scientific name +2169596 | Secondpapillomavirinae | | scientific name +2169609 | Kieseladnavirus | | scientific name +2169610 | Protobacilladnavirus | | scientific name +2169619 | Colecusatellite | | scientific name +2169650 | Alefpapillomavirus | | scientific name +2169663 | Porprismacovirus | | scientific name +2169692 | Alefpapillomavirus 1 | | scientific name +2169693 | Winged bean alphaendornavirus 1 | | scientific name +2169726 | Cacao yellow vein banding virus | | scientific name +2169726 | Cacao yellow vein-banding virus | | equivalent name +2169738 | Tomato yellow leaf curl Shuangbai virus | | scientific name +2169757 | Betapolyomavirus vicugnae | | scientific name +2169757 | Vicugna pacos polyomavirus 1 | | equivalent name +2169801 | Sambucus virus C | | scientific name +2169802 | Sambucus virus D | | scientific name +2169803 | Sambucus virus E | | scientific name +2169864 | Fusarium deltaflexivirus 1 | | scientific name +2169878 | Dyokappapapillomavirus 3 | | scientific name +2169879 | Dyokappapapillomavirus 4 | | scientific name +2169881 | Dyoxipapillomavirus 2 | | scientific name +2169885 | Enterovirus L | | scientific name +2169886 | Epsilonpapillomavirus 2 | | scientific name +2169902 | Gammapapillomavirus 27 | | scientific name +2169960 | Privet ringspot virus | | scientific name +2170064 | Mahlapitsi orthoreovirus | | scientific name +2170064 | Mahlapitsi virus | | equivalent name +2170103 | Thetapolyomavirus trepennellii | | scientific name +2170103 | Trematomus pennellii polyomavirus 1 | | equivalent name +2170103 | Trematomus polyomavirus 1 | | equivalent name +2170117 | Porcine associated porprismacovirus 10 | | scientific name +2170126 | Rat associated porprismacovirus 1 | | scientific name +2170132 | Barbacena virus Y | | scientific name +2170135 | Impatiens flower break potyvirus | | equivalent name +2170135 | Impatiens flower break virus | | scientific name +2170170 | Psipapillomavirus 2 | | scientific name +2170171 | Psipapillomavirus 3 | | scientific name +2170255 | Xipapillomavirus 4 | | scientific name +2172821 | Multicrustacea | | scientific name +2204151 | DNA viruses | | synonym +2204151 | unclassified DNA viruses | | scientific name +2218011 | Anoeconeossa unicornuta | | scientific name +2218011 | Anoeconeossa unicornuta Taylor, 1987 | | authority +2218046 | Diclidophlebia paucipunctata | | synonym +2218046 | Diclidophlebia paucipunctata (Brown & Hodkinson, 1988) | | authority +2218046 | Haplaphalara paucipunctata | | synonym +2218046 | Haplaphalara paucipunctata Brown & Hodkinson, 1988 | | authority +2218046 | Melanastera paucipunctata | | scientific name +2218046 | Melanastera paucipunctata (Brown & Hodkinson, 1988) | | authority +2218050 | Lanthanaphalara mira | | scientific name +2218050 | Lanthanaphalara mira Tuthill, 1959 | | authority +2218081 | Allocarsidara | | scientific name +2218081 | Allocarsidara Hollis, 1987 | | authority +2218082 | Allocarsidara bakeri | | scientific name +2218082 | Allocarsidara bakeri Hollis, 1987 | | authority +2218119 | Homotoma | | scientific name +2218119 | Homotoma Guerin-Meneville, 1844 | | authority +2218120 | Chermes ficus | | synonym +2218120 | Chermes ficus Linnaeus, 1758 | | authority +2218120 | Homotoma ficus | | scientific name +2218120 | Homotoma ficus (Linnaeus, 1758) | | authority +2218135 | Paracarsidara | | scientific name +2218135 | Paracarsidara Heslop-Harrison, 1960 | | authority +2218136 | Carsidara gigantea | | synonym +2218136 | Carsidara gigantea Crawford, 1911 | | authority +2218136 | Paracarsidara gigantea | | scientific name +2218136 | Paracarsidara gigantea (Crawford, 1911) | | authority +2218198 | Psyllinae | | scientific name +2219049 | Husa-like viruses | | equivalent name +2219049 | Husavirus | | scientific name +2219049 | human stool-associated RNA viruses | | equivalent name +2219055 | Porcine stool-associated RNA virus | | equivalent name +2219055 | Porcine stool-associated RNA viruses | | equivalent name +2219055 | Posavirus | | scientific name +2219055 | Posaviruses | | equivalent name +2219250 | Naprepa albicollis | | synonym +2219250 | Ocinara albicollis | | scientific name +2219250 | Ocinara albicollis (Walker, 1862) | | authority +2231382 | NPAAA clade | | scientific name +2231382 | canavanine-accumulating clade | | synonym +2231382 | non-protein amino acid accumulating clade | | synonym +2231384 | genistoids sensu lato | | scientific name +2231385 | core genistoids | | scientific name +2231387 | dalbergioids sensu lato | | scientific name +2231390 | Pterocarpus clade | | scientific name +2231393 | 50 kb inversion clade | | scientific name +2233855 | indigoferoid/millettioid clade | | scientific name +2248770 | Panax notoginseng virus B | | scientific name +2259808 | Mink bocavirus 1 | | scientific name +2290931 | Stenosarchaea | | equivalent name +2290931 | Stenosarchaea Aouad et al. 2018 | | authority +2290931 | Stenosarchaea group | | scientific name +2315733 | Cymbidium banaense | | scientific name +2315733 | Cymbidium banaense Gagnep., 1951 | | authority +2485233 | Apple hammerhead viroid | | equivalent name +2485233 | Pelamoviroid malleusmali | | scientific name +2486284 | Dactylogyridea | | scientific name +2497569 | Negarnaviricota | | scientific name +2497569 | Negative-strand RNA viruses | | common name +2497570 | Haploviricotina | | scientific name +2497571 | Polyploviricotina | | scientific name +2497572 | Chunqiuviricetes | | scientific name +2497574 | Monjiviricetes | | scientific name +2497574 | Mono-Chu-like virus sp. | | equivalent name +2497577 | Insthoviricetes | | scientific name +2499398 | Arnidovirineae | | scientific name +2499399 | Cornidovirineae | | scientific name +2499403 | Tornidovirineae | | scientific name +2499405 | Muvirales | | scientific name +2499407 | Jingchuvirales | | scientific name +2499411 | Articulavirales | | scientific name +2499606 | Simarterivirinae | | scientific name +2499615 | Iotaarterivirus | | scientific name +2499616 | Thetaarterivirus | | scientific name +2501926 | Rhinolophus ferrumequinum alphacoronavirus HuB-2013 | | scientific name +2501927 | Myotis ricketti alphacoronavirus Sax-2011 | | scientific name +2501928 | Nyctalus velutinus alphacoronavirus SC-2013 | | scientific name +2501931 | Orthocoronavirinae | | scientific name +2501940 | Mypoviridae | | scientific name +2501942 | Gerrid arlivirus | | equivalent name +2501942 | Sanstrivirus gerridis | | scientific name +2501945 | Ganiavirus tachengense | | scientific name +2501945 | Tacheng arlivirus | | equivalent name +2501949 | Amnoonviridae | | scientific name +2501952 | Chuviridae | | scientific name +2501968 | Qinviridae | | scientific name +2501970 | Shaspivirus | | scientific name +2501971 | Striwavirus | | scientific name +2501976 | Horwuvirus | | scientific name +2501985 | Xinmoviridae | | scientific name +2501987 | Lispiviridae | | scientific name +2501994 | Shangavirus | | scientific name +2501998 | Wuhivirus | | scientific name +2501999 | Thetaarterivirus kafuba | | scientific name +2507291 | Mivirus | | scientific name +2507320 | Xinzhou mivirus | | scientific name +2507497 | Yingvirus | | scientific name +2507505 | Xinzhou yingvirus | | equivalent name +2507505 | Yingvirus xinzhouense | | scientific name +2508209 | Tobaniviridae | | scientific name +2508239 | Remotovirinae | | scientific name +2508240 | Serpentovirinae | | scientific name +2508241 | Bostovirus | | scientific name +2508242 | Bosnitovirus | | scientific name +2508243 | Infratovirus | | scientific name +2508247 | Xintolivirus | | scientific name +2508251 | Infratovirus 1 | | scientific name +2508258 | Hubavirus | | scientific name +2508259 | Hubavirus myriapedis | | scientific name +2508259 | Myriapod hubavirus | | equivalent name +2509479 | Decacovirus | | scientific name +2509489 | Kaftartevirus | | scientific name +2509500 | Myotacovirus | | scientific name +2509503 | Nyctacovirus | | scientific name +2509509 | Rhinacovirus | | scientific name +2509514 | Tegacovirus | | scientific name +2545470 | Maize sterile stunt virus | | scientific name +2547355 | Bukakata virus | | scientific name +2547356 | Fomede virus | | scientific name +2555566 | Noctuini | | scientific name +2558200 | Accipitriformes | | scientific name +2558200 | hawks & eagles | hawks & eagles | blast name +2558200 | hawks & eagles | hawks & eagles | genbank common name +2559587 | RNA viruses | | common name +2559587 | RNA viruses and retroviruses | | genbank common name +2559587 | RNA viruses and viroids | | common name +2559587 | Riboviria | | scientific name +2560063 | Botourmiaviridae | | scientific name +2560069 | Avulavirinae | | scientific name +2560072 | Calvusvirinae | | scientific name +2560076 | Orthoparamyxovirinae | | scientific name +2560077 | Procedovirinae | | scientific name +2560078 | Regressovirinae | | scientific name +2560088 | Alphanemrhavirus | | scientific name +2560100 | Betachrysovirus | | scientific name +2560105 | Botoulivirus | | scientific name +2560185 | Narmovirus | | scientific name +2560194 | Orthoavulavirus | | scientific name +2560196 | Orthotospovirus | | scientific name +2560196 | Tospovirus | | equivalent name +2560218 | Salisharnavirus | | scientific name +2560230 | Sogarnavirus | | scientific name +2560252 | Wamavirus | | scientific name +2560254 | Wenrivirus | | scientific name +2560289 | Aino orthobunyavirus | | equivalent name +2560289 | Orthobunyavirus ainoense | | scientific name +2560321 | Avian avulavirus 13 | | equivalent name +2560321 | Avian orthoavulavirus 13 | | equivalent name +2560321 | Avian paramyxovirus (APMV/goose/Shimane/67/2000) | | equivalent name +2560321 | Avian paramyxovirus goose/Shimane/67/2000 | | synonym +2560321 | avian paramyxovirus 13 | | scientific name +2560349 | Blackberry virus F | | scientific name +2560351 | Botrytis botoulivirus | | scientific name +2560371 | Canna yellow mottle associated virus | | scientific name +2560371 | Canna yellow mottle-associated virus | | synonym +2560468 | Felid gammaherpesvirus 1 | | scientific name +2560468 | Felis catus gammaherpesvirus 1 | | equivalent name +2560479 | Betachrysovirus foxyspori | | scientific name +2560479 | Fusarium oxysporum chrysovirus 2 | | equivalent name +2560568 | Macaca nemestrina herpesvirus 7 | | equivalent name +2560568 | macacine betaherpesvirus 9 | | scientific name +2560614 | Nectarine stem pitting associated virus | | scientific name +2560614 | Nectarine stem pitting-associated virus | | equivalent name +2560620 | Palmarnavirus 128 | | scientific name +2560621 | Palmarnavirus 156 | | scientific name +2560622 | Palmarnavirus 473 | | scientific name +2560642 | Perigonia lusca nucleopolyhedrovirus | | scientific name +2560648 | Idaeovirus ligustri | | scientific name +2560648 | Privet idaeovirus | | equivalent name +2560649 | Deltapolyomavirus secuprocyonis | | scientific name +2560649 | Procyon lotor polyomavirus 2 | | equivalent name +2560801 | Testudinid alphaherpesvirus 3 | | scientific name +2560801 | Testudinid herpesvirus 3 | | equivalent name +2560801 | tortoise herpesvirus 3 | | equivalent name +2560845 | Alphanemrhavirus xingshan | | scientific name +2560845 | Xingshan alphanemrhavirus | | equivalent name +2560846 | Alphanemrhavirus xinzhou | | scientific name +2560846 | Xinzhou alphanemrhavirus | | equivalent name +2566501 | Cyclorhipidion bodoanum | | scientific name +2566501 | Cyclorhipidion bodoanus (Reitter, 1913) | | authority +2572045 | Tomato brown rugose fruit virus - Palestinian isolate | | scientific name +2576578 | unclassified Salisharnavirus | | scientific name +2585030 | unclassified RNA viruses | | equivalent name +2585030 | unclassified Riboviria | | scientific name +2585815 | Bucco haemacephalus | | synonym +2585815 | Bucco haemacephalus Muller, 1776 | | authority +2585815 | Megalaima haemacephala | | synonym +2585815 | Megalaima haemacephala (Statius Mller, 1776) | | authority +2585815 | Psilopogon haemacephalus | | scientific name +2585815 | coppersmith barbet | | genbank common name +2599620 | unclassified Mivirus | | scientific name +2609695 | DNA satellites | | scientific name +2613861 | unclassified Tospoviridae | | scientific name +2613861 | unclassified Tospovirus | | equivalent name +2621980 | unclassified Hafnia | | scientific name +2622732 | unclassified Haladaptatus | | scientific name +2654645 | Tomato brown rugose fruit virus Tom1-Jo | | scientific name +2670808 | unclassified Begomovirus-associated DNA beta-like sequences | | equivalent name +2670808 | unclassified Betasatellite | | scientific name +2670808 | unclassified betasatellites | | equivalent name +2684882 | Zygnematophycidae | | scientific name +2684882 | Zygnematophycidae Melkonian, Gontcharov & Marin, 2019 | | authority +2691594 | unclassified Rhinacovirus | | scientific name +2692248 | core chlorophytes | | scientific name +2696291 | Ochrophyta | | scientific name +2696291 | Ochrophyta Cavalier-Smith 1986 | | authority +2697495 | Spiralia | | scientific name +2698737 | SAR supergroup | | synonym +2698737 | Sar | | scientific name +2698737 | Sar Burki et al. 2008 | | authority +2707335 | Colletotrichum acutatum species complex | | scientific name +2707348 | Colletotrichum caudatum species complex | | includes +2707348 | Colletotrichum graminicola species complex | | scientific name +2721536 | Schizothoracinae | | scientific name +2731341 | Duplodnaviria | | scientific name +2731341 | double-stranded DNA viruses | | genbank common name +2731342 | Monodnaviria | | scientific name +2731342 | single-stranded DNA viruses | | genbank common name +2731360 | Heunggongvirae | | scientific name +2731361 | Peploviricota | | scientific name +2731363 | Herviviricetes | | scientific name +2732091 | Sangervirae | | scientific name +2732092 | Shotokuvirae | | scientific name +2732396 | Orthornavirae | | scientific name +2732397 | Pararnavirae | | scientific name +2732405 | Duplornaviricota | | scientific name +2732406 | Kitrinoviricota | | scientific name +2732406 | Tombus-Noda-like virus sp. | | equivalent name +2732407 | Lenarviricota | | scientific name +2732408 | Pisuviricota | | scientific name +2732409 | Artverviricota | | scientific name +2732412 | Phixviricota | | scientific name +2732413 | Malgrandaviricetes | | scientific name +2732414 | Petitvirales | | scientific name +2732415 | Cossaviricota | | scientific name +2732416 | Cressdnaviricota | | scientific name +2732416 | eukaryotic Rep-encoding ssDNA viruses | | common name +2732421 | Papovaviricetes | | scientific name +2732422 | Quintoviricetes | | scientific name +2732423 | Arfiviricetes | | scientific name +2732424 | Repensiviricetes | | scientific name +2732458 | Chrymotiviricetes | | scientific name +2732459 | Resentoviricetes | | scientific name +2732461 | Alsuviricetes | | scientific name +2732462 | Flasuviricetes | | scientific name +2732463 | Tolucaviricetes | | scientific name +2732464 | Magsaviricetes | | scientific name +2732498 | Amabiliviricetes | | scientific name +2732499 | Howeltoviricetes | | scientific name +2732500 | Miaviricetes | | scientific name +2732502 | Wolframvirales | | scientific name +2732503 | Cryppavirales | | scientific name +2732504 | Ourlivirales | | scientific name +2732505 | Duplopiviricetes | | scientific name +2732506 | Pisoniviricetes | | scientific name +2732507 | Stelpaviricetes | | scientific name +2732514 | Revtraviricetes | | scientific name +2732515 | Blubervirales | | scientific name +2732532 | Sepolyvirales | | scientific name +2732533 | Zurhausenvirales | | scientific name +2732534 | Piccovirales | | scientific name +2732535 | Baphyvirales | | scientific name +2732536 | Cirlivirales | | scientific name +2732537 | Cremevirales | | scientific name +2732538 | Mulpavirales | | scientific name +2732539 | Geplafuvirales | | scientific name +2732540 | Ghabrivirales | | scientific name +2732541 | Reovirales | | scientific name +2732541 | Reoviridae | | synonym +2732543 | Hepelivirales | | scientific name +2732544 | Martellivirales | | scientific name +2732545 | Amarillovirales | | scientific name +2732546 | Nodamuvirales | | scientific name +2732548 | Luteoviridae | | includes +2732548 | Tolivirales | | scientific name +2732549 | Durnavirales | | scientific name +2732550 | Patatavirales | | scientific name +2732551 | Stellavirales | | scientific name +2732553 | Sobelivirales | | scientific name +2732890 | Mayoviridae | | scientific name +2732892 | Mitoviridae | | scientific name +2733223 | Aquambidensovirus | | scientific name +2733224 | Blattambidensovirus | | scientific name +2733246 | Arurhavirus | | scientific name +2733248 | Betanucleorhabdovirus | | scientific name +2733254 | Sunrhavirus | | scientific name +2733256 | Bandavirus | | scientific name +2733256 | Banyangvirus | | equivalent name +2733291 | Parahepadnavirus | | scientific name +2733293 | Vaccinivirus | | scientific name +2734294 | Alphapolyomavirus quardecihominis | | scientific name +2734294 | Human polyomavirus 14 | | equivalent name +2734349 | Rosellinia necatrix betaendornavirus 1 | | scientific name +2734371 | Arurhavirus inhangapi | | scientific name +2734371 | Inhangapi arurhavirus | | equivalent name +2734385 | Cytorhabdovirus lycopersici | | scientific name +2734385 | Tomato yellow mottle-associated cytorhabdovirus | | equivalent name +2734386 | Cytorhabdovirus alphawuhaninsectum | | scientific name +2734386 | Wuhan 4 insect cytorhabdovirus | | equivalent name +2734387 | Cytorhabdovirus betawuhaninsectum | | scientific name +2734387 | Wuhan 5 insect cytorhabdovirus | | equivalent name +2734388 | Cytorhabdovirus gammawuhaninsectum | | scientific name +2734388 | Wuhan 6 insect cytorhabdovirus | | equivalent name +2734409 | Sunrhavirus walkabout | | scientific name +2734409 | Walkabout sunrhavirus | | equivalent name +2734433 | Adana phlebovirus | | equivalent name +2734433 | Phlebovirus adanaense | | scientific name +2734594 | Kabutovirus | | synonym +2734594 | Uukuvirus | | scientific name +2741926 | Amblemini | | scientific name +2741929 | Popenaidini | | scientific name +2743705 | Smiliogastrinae | | scientific name +2743714 | Gobionidae | | scientific name +2743715 | Gobioninae | | scientific name +2743716 | Sarcocheilichthyinae | | scientific name +2748958 | Bandavirus dabieense | | scientific name +2748958 | Dabie bandavirus | | synonym +2748958 | Huaiyangshan banyangvirus | | synonym +2748958 | SFTSV | SFTSV | acronym +2748959 | Betanucleorhabdovirus daturae | | scientific name +2748959 | DYVV | | acronym +2748959 | Datura yellow vein betanucleorhabdovirus | | equivalent name +2748967 | Iotaarterivirus pejah | | scientific name +2748967 | PBJV | PBJV | acronym +2756270 | Monochamus alternatus alternatus | | scientific name +2768478 | Deltocephalini | | scientific name +2768478 | Deltocephalini Dallas, 1870 | | authority +2785011 | Autobranchia | | scientific name +2785015 | Imparidentia | | scientific name +2788829 | unclassified Resentoviricetes | | scientific name +2788833 | unclassified Tolucaviricetes | | scientific name +2788857 | unclassified Zurhausenvirales | | scientific name +2788865 | unclassified Reovirales | | scientific name +2788865 | unclassified Reoviridae | | synonym +2789204 | Enterobacteria allolevivirus II | | equivalent name +2789204 | Enterobacteria phage FI sensu lato | | equivalent name +2789204 | Escherichia phage FI | | scientific name +2797651 | Zygometra comata | | scientific name +2797651 | Zygometra comata Clark, 1911 | | authority +2810354 | Isognathotermes | | scientific name +2810354 | Isognathotermes Sjostedt, 1926 | | authority +2811596 | Iberoporus pluto | | scientific name +2811596 | Iberoporus pluto Ribera & Reboleira, 2019 | | authority +2812636 | CS clade | | scientific name +2812636 | SV clade | | includes +2821351 | Conifers II | | scientific name +2839668 | Tagiadinae | | scientific name +2840056 | Baculovirus-related double-stranded DNA viruses of arthropods | | common name +2840056 | Naldaviricetes | | scientific name +2840070 | Lefavirales | | scientific name +2841720 | Asterinae | | scientific name +2841720 | Asterinae Dumort., 1827 | | authority +2842243 | Allassoviricetes | | synonym +2842243 | Leviviricetes | | scientific name +2842243 | prokaryotic virus | prokaryotic virus | in-part +2842247 | Levivirales | | synonym +2842247 | Norzivirales | | scientific name +2842313 | Aliusviridae | | scientific name +2842319 | Fiersviridae | | scientific name +2842319 | Leviviridae | | synonym +2842319 | bacterial virus | bacterial virus | in-part +2842319 | bacterial viruses | bacterial viruses | in-part +2842319 | prokaryotic virus | prokaryotic virus | in-part +2842325 | Natareviridae | | scientific name +2842369 | Alphadrosrhavirus | | scientific name +2842407 | Alpharhabdovirinae | | scientific name +2842408 | Betarhabdovirinae | | scientific name +2842542 | Alpharicinrhavirus | | scientific name +2842594 | Charybdivirus | | scientific name +2842607 | Citlodavirus | | scientific name +2842620 | Culicidavirus | | scientific name +2842645 | Diciambidensovirus | | scientific name +2842680 | Felismacovirus | | scientific name +2842848 | Maldovirus | | scientific name +2842882 | Morsusvirus | | scientific name +2842921 | Ollusvirus | | scientific name +2842923 | Omegatorquevirus | | scientific name +2842950 | Penoulivirus | | scientific name +2842995 | Allolevivirus | | synonym +2842995 | Qubevirus | | scientific name +2843481 | Peiartevirus | | scientific name +2843859 | Alpharicinrhavirus bole | | scientific name +2843859 | BlTV-2 | | acronym +2843859 | Bole alpharicinrhavirus | | equivalent name +2843935 | Charybdivirus charybdis | | scientific name +2843935 | WzCV-3 | | acronym +2844037 | Culicidavirus culicidae | | scientific name +2844037 | WhMV-8 | | acronym +2844039 | Culicidavirus imjinense | | scientific name +2844039 | IjRV-1 | | acronym +2844095 | Domestica sigmavirus | | equivalent name +2844095 | Sigmavirus domestica | | scientific name +2844095 | WhFV-2 | | acronym +2844423 | BoGCV1 | | acronym +2844423 | Gemycircularvirus bovas1 | | scientific name +2844427 | ChiGCV1 | | acronym +2844427 | Gemycircularvirus chicas1 | | scientific name +2844428 | ChiGCV2 | | acronym +2844428 | Gemycircularvirus chicas2 | | scientific name +2844429 | ChGCV1 | | acronym +2844429 | Gemycircularvirus chickad1 | | scientific name +2844440 | Gemycircularvirus echiam1 | | scientific name +2844441 | EGCV1 | | acronym +2844441 | Gemycircularvirus equas1 | | scientific name +2844504 | Gemycircularvirus poass1 | | scientific name +2844504 | PGCV1 | | acronym +2844505 | Gemycircularvirus porci1 | | scientific name +2844505 | PoGCV1 | | acronym +2844518 | Gemycircularvirus ratas1 | | scientific name +2844518 | RGCV1 | | acronym +2844528 | Gemycircularvirus sheas1 | | scientific name +2844528 | ShGCV1 | | acronym +2844548 | CGGV1 | | acronym +2844548 | Gemygorvirus cania1 | | scientific name +2844550 | Gemygorvirus malas1 | | scientific name +2844550 | MGGV1 | | acronym +2844569 | Gemykibivirus echi1 | | scientific name +2844585 | Gemykibivirus humas5 | | scientific name +2844585 | HGKV5 | | acronym +2844603 | Gemykibivirus sewopo1 | | scientific name +2844603 | SeGKV1 | | acronym +2844612 | Gemykolovirus echia1 | | scientific name +2844799 | GyV8 | | acronym +2844799 | Gyrovirus fulgla1 | | scientific name +2844804 | GyV4 | GyV4 | acronym +2844804 | Gyrovirus homsa3 | | scientific name +2844833 | Hippoboscid sigmavirus | | equivalent name +2844833 | Sigmavirus hippoboscid | | scientific name +2844833 | WhLFV-9 | | acronym +2844861 | Alphadrosrhavirus hubei | | scientific name +2844861 | Hubei alphadrosrhavirus | | equivalent name +2844861 | WhHFV-2 | | acronym +2845539 | Lousefly sigmavirus | | equivalent name +2845539 | Sigmavirus lousefly | | scientific name +2845539 | WhLFV-10 | | acronym +2845619 | Mivirus boleense | | scientific name +2845620 | CpTV-2 | | acronym +2845620 | Mivirus changpingense | | scientific name +2845621 | CpTV-3 | | acronym +2845621 | Mivirus dermacentoris | | scientific name +2845625 | Mivirus suffolkense | | scientific name +2845625 | SFKV | | acronym +2845626 | Mivirus wuhanense | | scientific name +2845626 | WhTV-2 | | acronym +2845639 | Morsusvirus argatis | | scientific name +2845639 | TcTV-4 | | acronym +2845713 | Ollusvirus shayangense | | scientific name +2845713 | Olluvirus shayangense | | equivalent name +2845835 | Phomosis penoulivirus | | scientific name +2845835 | PlRV1 | | acronym +2845912 | Porprismacovirus porci10 | | scientific name +2845922 | Porprismacovirus porci1 | | scientific name +2845932 | Porprismacovirus ratas1 | | scientific name +2846193 | Alphadrosrhavirus shayang | | scientific name +2846193 | Shayang alphadrosrhavirus | | equivalent name +2846193 | SyFV-3 | | acronym +2846195 | Shayang sigmavirus | | equivalent name +2846195 | Sigmavirus shayang | | scientific name +2846195 | SyFV-1 | | equivalent name +2846667 | Alpharicinrhavirus wuhan | | scientific name +2846667 | WhTV-1 | | acronym +2846667 | Wuhan alpharicinrhavirus | | equivalent name +2846668 | Sigmavirus wuhan | | scientific name +2846668 | WhHFV-1 | | acronym +2846668 | Wuhan sigmavirus | | equivalent name +2847088 | GB virus D | | equivalent name +2847088 | GB virus-D | | scientific name +2847270 | Picornaviridae sp. rodent/RL/PicoV/FJ2015 | | equivalent name +2847270 | rosavirus C4 | | scientific name +2847522 | Herona marathus angustata | | scientific name +2847522 | Herona marathus angustata Moore, 1878 | | authority +2848317 | Trichechus manatus latirostris papillomavirus 4 | | scientific name +2848317 | Trichechus manatus papillomavirus 4 | | equivalent name +2866655 | Bos arnee | | synonym +2866655 | Bos arnee Kerr, 1792 | | authority +2866655 | Bubalus arnee | | scientific name +2866655 | Bubalus arnee (Kerr, 1792) | | authority +2866655 | wild water buffalo | | genbank common name +2867347 | Retinodendron rassak | | synonym +2867347 | Retinodendron rassak Korth., 1840 | | authority +2867347 | Vatica rassak | | scientific name +2867347 | Vatica rassak (Korth.) Blume, 1856 | | authority +2870378 | Miniopterus schreibersii picornavirus 1 | | equivalent name +2870378 | mischivirus A1 | | scientific name +2871195 | rosavirus B1 | | scientific name +2871196 | rosavirus B2 | | scientific name +2876817 | Vatica xishuangbannaensis | | scientific name +2876817 | Vatica xishuangbannaensis G.D.Tao & J.H.Zhang, 1983 | | authority +2890311 | Klebsiella/Raoultella group | | scientific name +2908833 | Neoheterodontei | | scientific name +2914707 | Apachyus feae | | scientific name +2914707 | Apachyus feae de Bormans, 1894 | | authority +2916678 | CTG clade | | common name +2916678 | CUG-Ser1 clade | | genbank common name +2916678 | Serinales | | scientific name +2916678 | Serinales M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority +2927998 | Arremon aurantiirostris erythrorhynchus | | scientific name +2927998 | Arremon aurantiirostris erythrorhynchus Sclater, 1855 | | authority +2927999 | Arremon aurantiirostris spectabilis | | scientific name +2927999 | Arremon aurantiirostris spectabilis Sclater, 1855 | | authority +2928000 | Arremon aurantiirostris occidentalis | | scientific name +2928000 | Arremon aurantiirostris occidentalis Hellmayr, 1911 | | authority +2928001 | Arremon aurantiirostris strictocollaris | | scientific name +2928001 | Arremon aurantiirostris strictocollaris Todd, 1922 | | authority +2928006 | Arremon aurantiirostris aurantiirostris | | scientific name +2928006 | Arremon aurantiirostris aurantiirostris Lafresnaye, 1847 | | authority +2928007 | Arremon aurantiirostris saturatus | | scientific name +2928007 | Arremon aurantiirostris saturatus Cherrie, 1891 | | authority +2928008 | Arremon aurantiirostris santarosae | | scientific name +2928008 | Arremon aurantiirostris santarosae Chapman, 1925 | | authority +2932129 | Phragmipedium hirtzii | | scientific name +2932129 | Phragmipedium hirtzii Dodson, 1988 | | authority +2942679 | Rohanvirales | | scientific name +2942681 | Yadokarivirales | | scientific name +2946186 | Sedoreoviridae | | scientific name +2946186 | Sedoreovirinae | | synonym +2946187 | Spinareoviridae | | scientific name +2946187 | Spinareovirinae | | synonym +2946194 | Yadokariviridae | | scientific name +2946627 | Caphthovirinae | | scientific name +2946630 | Ensavirinae | | scientific name +2946633 | Heptrevirinae | | scientific name +2946635 | Kodimesavirinae | | scientific name +2946639 | Orthohepevirinae | | scientific name +2946640 | Paavivirinae | | scientific name +2946790 | Alphafusarivirus | | scientific name +2946823 | Betafusarivirus | | scientific name +2946827 | Betayadokarivirus | | scientific name +2948661 | Chirohepevirus | | scientific name +2948686 | Duamitovirus | | scientific name +2948721 | Ganiavirus | | scientific name +2948851 | Orthopicobirnavirus | | scientific name +2948851 | Picobirnavirus | | equivalent name +2948893 | Sanstrivirus | | scientific name +2948924 | Thetapolyomavirus | | scientific name +2948930 | Tralespevirus | | scientific name +2948932 | Triamitovirus | | scientific name +2948940 | Unuamitovirus | | scientific name +2955264 | Alphafusarivirus ioaponiae | | scientific name +2955269 | Alphafusarivirus penicilli | | scientific name +2955271 | Alphafusarivirus pleosporae | | scientific name +2955296 | Alphapolyomavirus mischreibersii | | scientific name +2955300 | Alphapolyomavirus ranorvegicus | | scientific name +2955303 | Alphapolyomavirus secumischreibersii | | scientific name +2955369 | Apscaviroid glvd | | equivalent name +2955369 | Apscaviroid latensvitis | | scientific name +2955443 | Betachrysovirus pripenicillii | | scientific name +2955454 | Betafusarivirus sclerotiniae | | scientific name +2955468 | Betapolyomavirus marvalis | | scientific name +2955470 | Betapolyomavirus myoglareolus | | scientific name +2955472 | Betapolyomavirus raegyptiacus | | scientific name +2955492 | Betayadokarivirus ichibani | | scientific name +2955588 | Carlavirus PepVA | | scientific name +2955770 | Duamitovirus boci3 | | scientific name +2955781 | Duamitovirus fupo3 | | scientific name +2955782 | Duamitovirus fupo4 | | scientific name +2955836 | Duamitovirus scsc3 | | scientific name +2956328 | Pospiviroid plvd | | scientific name +2956522 | Thetapolyomavirus spari | | scientific name +2956541 | Tralespevirus gompholobii | | scientific name +2956547 | Triamitovirus rhor1 | | scientific name +2956583 | Unuamitovirus alar1 | | scientific name +2956585 | Unuamitovirus boci2 | | scientific name +2956586 | Unuamitovirus boci4 | | scientific name +2956587 | Unuamitovirus crri1 | | scientific name +2956588 | Unuamitovirus crri2 | | scientific name +2956589 | Unuamitovirus crri3 | | scientific name +2956590 | Unuamitovirus crri4 | | scientific name +2956591 | Unuamitovirus crri5 | | scientific name +2956607 | Unuamitovirus fupo1 | | scientific name +2956608 | Unuamitovirus fupo2 | | scientific name +2960224 | unclassified Ensavirinae | | scientific name +2960910 | unclassified Orthopicobirnavirus | | scientific name +2960910 | unclassified Picobirnavirus | | equivalent name +2965324 | Paris lancifolia | | scientific name +2965324 | Paris lancifolia Hayata, 1906 | | authority +2976112 | Jeffersonieae | | scientific name +2976112 | Jeffersonieae C.L.Hsieh, C.C.Yu & K.F.Chung, 2022 | | authority +2976338 | Myotis nigricans osculatii | | scientific name +2976338 | Myotis nigricans osculatii (Cornalia 1849) | | authority +2976338 | Myotis osculatii | | synonym +2976338 | Myotis osculatii (Cornalia, 1849) | | authority +2976338 | Vespertilio osculatii | | synonym +2976338 | Vespertilio osculatii Cornalia, 1849 | | authority +2980669 | Myotis yumanensis yumanensis | | scientific name +2980669 | Vespertilio yumanensis yumanensis | | synonym +2980669 | Vespertilio yumanensis yumanensis Allen, 1864 | | authority +2982303 | Tricholomatineae | | scientific name +2982303 | Tricholomatineae Aime, Dentinger & Gaya, 2015 | | authority +2982305 | Agaricineae | | scientific name +2982305 | Agaricineae Fr., emend. Aime, Dentinger & Gaya, 2015 | | authority +2982316 | Marasmiineae | | scientific name +2982316 | Marasmiineae Aime, Dentinger & Gaya, 2015 | | authority +2982806 | Jingmenvirus group | | scientific name +2982806 | unclassified Jingmenvirus group | | includes +3004043 | Calorhabdos latifolia | | synonym +3004043 | Calorhabdos latifolia Hemsl., 1890 | | authority +3004043 | Veronicastrum latifolium | | scientific name +3004043 | Veronicastrum latifolium (Hemsl.) T.Yamaz., 1957 | | authority +3039755 | Neodermaptera | | scientific name +3039756 | Epidermaptera | | scientific name +3042114 | Anthophila | Anthophila | scientific name +3042114 | bees | bees | blast name +3042114 | bees | bees | genbank common name +3044472 | Orthoherpesviridae | | scientific name +3047382 | Caulimovirus maculatractylodei | | scientific name +3047678 | Comovirus rugomusivum | | scientific name +3047681 | Waikavirus campanulae | | scientific name +3047686 | Badnavirus phirubi | | scientific name +3047704 | Alphabaculovirus busuppressariae | | scientific name +3047706 | Badnavirus tessellotheobromae | | scientific name +3047715 | Badnavirus venatheobromae | | scientific name +3047722 | Badnavirus alphamaculaflavicannae | | scientific name +3047737 | Alphabaculovirus capomonae | | scientific name +3047760 | Pelarspovirus clematis | | scientific name +3047783 | Cheravirus ribis | | scientific name +3047795 | Betabaculovirus disaccharalis | | scientific name +3047819 | Tombusvirus melongenae | | scientific name +3047843 | Badnavirus venaribis | | scientific name +3047845 | Nepovirus anatoliense | | scientific name +3047850 | Nepovirus deformationis | | scientific name +3047854 | Badnavirus decoloratiovitis | | scientific name +3048157 | Umbravirus ixeridii | | scientific name +3048204 | Betabaculovirus molatipedis | | scientific name +3048218 | Marafivirus nucipersicae | | scientific name +3048219 | Luteovirus nucipersicae | | scientific name +3048236 | Umbravirus papaveri | | scientific name +3048251 | Nepovirus persicae | | scientific name +3048283 | Alphanecrovirus solani | | scientific name +3048345 | Alphabaculovirus sujujubae | | scientific name +3048399 | Betatorquevirus homini32 | | scientific name +3048408 | Iotatorquevirus suida1a | | scientific name +3048442 | Alphabaculovirus urprotei | | scientific name +3048451 | Badnavirus wisteriae | | scientific name +3048458 | Circovirus zebrafinch | | scientific name +3050241 | Circovirus bastao | | scientific name +3050251 | Varicellovirus canidalpha1 | | scientific name +3050258 | Cytomegalovirus cercopithecinebeta5 | | scientific name +3050262 | Scutavirus chelonidalpha5 | | scientific name +3050267 | Mardivirus columbidalpha1 | | scientific name +3050285 | Percavirus felidgamma1 | | scientific name +3050304 | Simplexvirus leporidalpha4 | | scientific name +3050310 | Roseolovirus macacinebeta9 | | scientific name +3050317 | Simplexvirus macropodidalpha1 | | scientific name +3050360 | Scutavirus testudinidalpha3 | | scientific name +3050361 | Betatorquevirus homini18 | | scientific name +3050363 | Bocaparvovirus ungulate6 | | scientific name +3051377 | Orthoavulavirus japanense | | scientific name +3051421 | Alphabaculovirus peluscae | | scientific name +3051977 | Aquambidensovirus decapod1 | | scientific name +3051977 | CqDV | | acronym +3051977 | Decapod ambidensovirus 1 | | synonym +3051977 | Decapod aquambidensovirus 1 | | equivalent name +3051989 | Bandavirus bhanjanagarense | | scientific name +3051989 | Bhanja bandavirus | | equivalent name +3052031 | Bocaparvovirus carnivoran6 | | scientific name +3052031 | Carnivore bocaparvovirus 6 | | equivalent name +3052037 | Bocaparvovirus lagomorph1 | | scientific name +3052037 | Lagomorph bocaparvovirus 1 | | equivalent name +3052043 | Bocaparvovirus rodent1 | | scientific name +3052043 | Rodent bocaparvovirus 1 | | equivalent name +3052135 | Circovirus yaa | | scientific name +3052135 | Tick associated circovirus 1 | | equivalent name +3052163 | Cyclovirus risi | | scientific name +3052180 | Dependoparvovirus squamate2 | | scientific name +3052180 | Squamate dependoparvovirus 2 | | equivalent name +3052183 | DcDV | | acronym +3052183 | Diciambidensovirus hemipteran1 | | scientific name +3052183 | Hemipteran diciambidensovirus 1 | | equivalent name +3052212 | Goukovirus yichangense | | scientific name +3052212 | Yichang insect goukovirus | | equivalent name +3052248 | Horsefly horwuvirus | | equivalent name +3052248 | Horwuvirus wuhanense | | scientific name +3052256 | Iteradensovirus lepidopteran2 | | scientific name +3052256 | Lepidopteran iteradensovirus 2 | | equivalent name +3052258 | Iteradensovirus lepidopteran4 | | scientific name +3052258 | Lepidopteran iteradensovirus 4 | | equivalent name +3052270 | Avon-Heathcote Estuary associated kieseladnavirus | | equivalent name +3052270 | Kieseladnavirus ampcren | | scientific name +3052318 | Arenavirus N27 | | equivalent name +3052318 | MRTV | | acronym +3052318 | Mammarenavirus marientalense | | scientific name +3052318 | Mariental mammarenavirus | | equivalent name +3052318 | Mariental virus | | equivalent name +3052318 | Mariental virus N27 | | equivalent name +3052321 | Arenavirus N73 | | equivalent name +3052321 | Mammarenavirus okahandjaense | | scientific name +3052321 | OKAV | | acronym +3052321 | Okahandja mammarenavirus | | equivalent name +3052321 | Okahandja virus | | equivalent name +3052321 | Okahandja virus N73 | | equivalent name +3052333 | Marafivirus pruni | | scientific name +3052333 | Peach marafivirus D | | equivalent name +3052347 | Morbillivirus phocae | | scientific name +3052353 | Nariva narmovirus | | equivalent name +3052353 | Narmovirus narivaense | | scientific name +3052366 | Omegatorquevirus hominid1 | | scientific name +3052366 | Torque teno hominid virus 1 | | equivalent name +3052437 | Orthobunyavirus schmallenbergense | | scientific name +3052437 | Schmallenberg orthobunyavirus | | equivalent name +3052441 | Orthobunyavirus simbuense | | scientific name +3052441 | Simbu bunyavirus group | | equivalent name +3052441 | Simbu orthobunyavirus | | equivalent name +3052441 | Simbu serogroup | | equivalent name +3052441 | Simbu virus | | equivalent name +3052441 | Simbu virus Group | | equivalent name +3052520 | HpTV-1 | | acronym +3052520 | Huangpi orthonairovirus | | equivalent name +3052520 | Orthonairovirus huangpiense | | scientific name +3052522 | Orthonairovirus japonicum | | scientific name +3052522 | Tofla orthonairovirus | | equivalent name +3052523 | Kasokero orthonairovirus | | equivalent name +3052523 | Orthonairovirus kasokeroense | | scientific name +3052536 | Orthonairovirus tachengense | | scientific name +3052536 | Tacheng orthonairovirus | | equivalent name +3052536 | TcTV-1 | | acronym +3052540 | Orthonairovirus wenzhouense | | scientific name +3052540 | Wenzhou orthonairovirus | | equivalent name +3052540 | WzTV | | acronym +3052541 | Orthonairovirus yogueense | | scientific name +3052541 | YOGV | | acronym +3052541 | Yogue orthonairovirus | | equivalent name +3052543 | Orthophasmavirus aedis | | scientific name +3052543 | Wuhan mosquito orthophasmavirus 2 | | equivalent name +3052553 | Orthophasmavirus wuchangense | | scientific name +3052553 | Wuchang cockroach orthophasmavirus 1 | | equivalent name +3052554 | Orthophasmavirus wuhanense | | scientific name +3052554 | Wuhan mosquito orthophasmavirus 1 | | equivalent name +3052569 | Orthotospovirus capsicimaculaflavi | | scientific name +3052569 | Pepper chlorotic spot orthotospovirus | | equivalent name +3052570 | Chrysanthemum stem necrosis orthotospovirus | | equivalent name +3052570 | Orthotospovirus chrysanthinecrocaulis | | scientific name +3052577 | Iris yellow spot orthotospovirus | | equivalent name +3052577 | Iris yellow spot tospovirus | | equivalent name +3052577 | Orthotospovirus iridimaculaflavi | | scientific name +3052579 | Melon severe mosaic orthotospovirus | | equivalent name +3052579 | Orthotospovirus melotessellati | | scientific name +3052581 | Bean necrotic mosaic orthotospovirus | | equivalent name +3052581 | Orthotospovirus phaseolinecrotessellati | | scientific name +3052606 | Pegivirus H | | equivalent name +3052606 | Pegivirus columbiaense | | scientific name +3052611 | Pegivirus B | | equivalent name +3052611 | Pegivirus pteropi | | scientific name +3052624 | Pestivirus K | | equivalent name +3052624 | Pestivirus scrofae | | scientific name +3052632 | Fly phasivirus | | equivalent name +3052632 | Phasivirus wuhanense | | scientific name +3052632 | WhFV-1 | | acronym +3052633 | Phasivirus wutaiense | | scientific name +3052633 | Wutai Mosquito Virus | | equivalent name +3052633 | Wutai mosquito phasivirus | | equivalent name +3052665 | Munguba phlebovirus | | equivalent name +3052665 | Phlebovirus mungubaense | | scientific name +3052666 | Phlebovirus napoliense | | scientific name +3052685 | Phlebovirus torosense | | scientific name +3052685 | Toros phlebovirus | | equivalent name +3052690 | Phlebovirus zerdaliense | | scientific name +3052690 | Zerdali phlebovirus | | equivalent name +3052702 | Chaetoceros protobacilladnavirus 2 | | equivalent name +3052702 | Protobacilladnavirus chaetoc | | scientific name +3052704 | Protobacilladnavirus hasleos | | scientific name +3052704 | Snail associated protobacilladnavirus 2 | | equivalent name +3052705 | Protobacilladnavirus mudflat | | scientific name +3052705 | Snail associated protobacilladnavirus 1 | | equivalent name +3052711 | Chiropteran protoparvovirus 1 | | equivalent name +3052711 | Protoparvovirus chiropteran1 | | scientific name +3052719 | Protoparvovirus rodent3 | | scientific name +3052719 | Rodent protoparvovirus 3 | | equivalent name +3052723 | Golden reptarenavirus | | equivalent name +3052723 | Reptarenavirus aurei | | scientific name +3052724 | California reptarenavirus | | equivalent name +3052724 | Reptarenavirus californiae | | scientific name +3052730 | Caprine respirovirus 3 | | equivalent name +3052730 | Respirovirus caprae | | scientific name +3052748 | Insect shangavirus | | equivalent name +3052748 | Shangavirus shuangaoense | | scientific name +3052748 | Shuangao insect herbevirus 1 | | equivalent name +3052749 | Shaspivirus aranei | | scientific name +3052749 | Spider shaspivirus | | equivalent name +3052756 | Strider striwavirus | | equivalent name +3052756 | Striwavirus sanxiaense | | scientific name +3052771 | Tetraparvovirus ungulate 1 | | includes +3052771 | Tetraparvovirus ungulate1 | | scientific name +3052771 | Ungulate tetraparvovirus 1 | | equivalent name +3052800 | HpTV-2 | | acronym +3052800 | Huangpi uukuvirus | | equivalent name +3052800 | Uukuvirus huangpiense | | scientific name +3052813 | Blueberry fruit drop associated virus | | equivalent name +3052813 | Vaccinivirus cadovaccinii | | scientific name +3052826 | Shrimp wenrivirus | | equivalent name +3052826 | Wenrivirus penaei | | scientific name +3052827 | Insect wuhivirus | | equivalent name +3052827 | Wuhivirus insecti | | scientific name +3054905 | Moreae | | scientific name +3054905 | Moreae Dumort., 1829 | | authority +3058443 | SCWL tick virus | | scientific name +3058444 | Sichuan tick virus | | scientific name +3059782 | Blattambidensovirus incertum1 | | scientific name +3060718 | Soymovirus eleocharis | | scientific name +3064797 | Haladaptataceae | | scientific name +3064797 | Haladaptataceae Chuvochina et al. 2024 | | synonym +3064797 | Haladaptataceae Cui et al. 2023 | | authority +3072906 | Musteloidea | | scientific name +3073806 | Otidimorphae | | scientific name +3073806 | bustards, cuckoos & allies | | genbank common name +3073808 | Telluraves | | scientific name +3073808 | core landbirds | | genbank common name +3073809 | Australaves | | scientific name +3073809 | Australaves Ericson, 2011 | | authority +3073810 | Coraciimorphae | | scientific name +3073811 | Accipitrimorphae | | scientific name +3073812 | Aequornithes | | scientific name +3073812 | Aequornithes Mayr, 2011 | | authority +3073812 | core waterbirds | | genbank common name +3078114 | Neoaves | | scientific name +3079366 | Hepeviridae | | scientific name +3079366 | Hepeviridae_temp | | equivalent name +3101718 | Carsidarinae | | scientific name +3118152 | Hafnia sp. KE9867 | | scientific name +3137121 | Anemone | | scientific name +3137121 | Anemone L., 1753 | | authority +3143224 | Melanastera | | scientific name +3143224 | Melanastera Serbina, Malenovsky, Queiroz & Burckhardt, 2023 | | authority +3151693 | Bunyaviricetes | | scientific name +3151837 | Elliovirales | | scientific name +3151838 | Gredzevirales | | scientific name +3151839 | Hareavirales | | scientific name +3151840 | Jormunvirales | | scientific name +3151845 | Saturnivirales | | scientific name +3152106 | Adamaviridae | | scientific name +3152107 | Anicreviridae | | scientific name +3152110 | Botybirnaviridae | | scientific name +3152116 | Draupnirviridae | | scientific name +3152119 | Fusagraviridae | | scientific name +3152120 | Gandrviridae | | scientific name +3152124 | Inseviridae | | scientific name +3152126 | Kanorauviridae | | scientific name +3152141 | Orthototiviridae | | scientific name +3152142 | Ouroboviridae | | scientific name +3152144 | Phlegiviridae | | scientific name +3152146 | Pistolviridae | | scientific name +3152147 | Pseudototiviridae | | scientific name +3152207 | Deltarhabdovirinae | | scientific name +3152209 | Feraresvirinae | | scientific name +3152475 | Celebovirus | | scientific name +3152483 | Stoorivirus | | scientific name +3152501 | Manawavirus | | scientific name +3152639 | Gammaricinrhavirus | | scientific name +3152641 | Stangrhavirus | | scientific name +3152653 | Citiorivirus | | scientific name +3152867 | Fusagravirus | | scientific name +3152873 | Satyrivirus | | scientific name +3152905 | Insevirus | | scientific name +3152926 | Ninurtavirus | | scientific name +3153030 | Dorisivirus | | scientific name +3153055 | Tethyvirus | | scientific name +3153067 | Phlegivirus | | scientific name +3153072 | Pistolvirus | | scientific name +3239873 | Dipodascomycetes | | scientific name +3239873 | Dipodascomycetes M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority +3239874 | Pichiomycetes | | scientific name +3239874 | Pichiomycetes M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority +3240463 | Potyvirus alliumagrestis | | scientific name +3240468 | Potyvirus arracachae | | scientific name +3240474 | Potyvirus barbacenense | | scientific name +3240485 | Potyvirus calistephi | | scientific name +3240497 | Potyvirus caryae | | scientific name +3240498 | Potyvirus catharantessellati | | scientific name +3240517 | Potyvirus cyrtanthi | | scientific name +3240525 | Potyvirus duobatatae | | scientific name +3240527 | Potyvirus euphorbiae | | scientific name +3240530 | Potyvirus gebatatae | | scientific name +3240544 | Potyvirus hippeastri | | scientific name +3240546 | Potyvirus impatiensis | | scientific name +3240548 | Potyvirus iriseverum | | scientific name +3240550 | Potyvirus jasmini | | scientific name +3240554 | Potyvirus lactucaitalicense | | scientific name +3240568 | Potyvirus nicotianamaculae | | scientific name +3241188 | apricot vein clearing associated virus | | scientific name +3243772 | Dipodascales | | scientific name +3243772 | Dipodascales M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority +3243775 | Pichiales | | scientific name +3243775 | Pichiales M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority +3303203 | CAH clade | | common name +3303203 | Candidozyma | | scientific name +3303203 | Candidozyma Q.M. Wang, Yurkov, Boekhout & F.Y. Bai, 2024 | | authority +3342348 | Oceanites oceanicus chilensis | | scientific name +3342348 | Oceanites oceanicus chilensis Murphy, 1936 | | authority +3358290 | Formosan arrowfin goby | | genbank common name +3358290 | Oligolepis formosanus | | scientific name +3358290 | Oligolepis formosanus (Nichols, 1958) | | authority +3358290 | Oxyurichthys formosanus | | synonym +3358290 | Oxyurichthys formosanus Nichols, 1958 | | authority +3366610 | "Euryarchaeida" Luketa 2012 | | authority +3366610 | Euryarchaeida | | synonym +3366610 | Methanobacteriati | | scientific name +3366610 | Methanobacteriati (Garrity and Holt 2023) Oren and Goker 2024 | | authority +3368986 | Haladaptatus sp. CMAA 1909 | | scientific name +3368987 | Haladaptatus sp. CMAA 1911 | | scientific name +3379134 | Pseudomonadati | | scientific name +3379134 | Pseudomonadati (Gibbons and Murray 1978) Oren and Goker 2024 | | authority +3390273 | Klebsiella pneumoniae complex | | scientific name +3403061 | Viruses incertae sedis | | scientific name +3412625 | Commensaviricota | | scientific name +3412723 | Cardeaviricetes | | scientific name +3415267 | Alphatotivirineae | | scientific name +3417955 | Entransiales | | scientific name +3417957 | Entransiaceae | | scientific name +3420546 | Sanitavirales | | scientific name +3421323 | Betatotivirineae | | scientific name +3424890 | Alphacytorhabdovirus | | scientific name +3424891 | Betacytorhabdovirus | | scientific name +3424976 | Unirnavirus | | scientific name +3425084 | Crabreovirus | | scientific name +3425096 | Rhabdoviridae incertae sedis | | scientific name +3425105 | Alphaplatrhavirus | | scientific name +3425826 | Ritunrivirus | | scientific name +3426109 | Alphacytorhabdovirus alphawuhaninsectum | | scientific name +3426122 | Alphacytorhabdovirus betawuhaninsectum | | scientific name +3426137 | Alphacytorhabdovirus gammawuhaninsectus | | scientific name +3426146 | Alphacytorhabdovirus lycopersici | | scientific name +3426172 | Alphaendornavirus cucumis | | scientific name +3426174 | Alphaendornavirus erysiphes | | scientific name +3426175 | Alphaendornavirus fucapsici | | scientific name +3426179 | Alphaendornavirus hordei | | scientific name +3426186 | Alphaendornavirus psophocarpi | | scientific name +3426258 | Alphaplatrhavirus vulpes | | scientific name +3426277 | Alpharicinrhavirus huangpi | | scientific name +3426285 | Alpharicinrhavirus taishun | | scientific name +3426347 | Ampelovirus tredecimvitis | | scientific name +3426670 | Begomovirus abelsmoschusomanense | | scientific name +3426674 | Begomovirus ageravenae | | scientific name +3426677 | Begomovirus alceamuvisi | | scientific name +3426712 | Begomovirus capsicumthailandense | | scientific name +3426730 | Begomovirus chlorocucumis | | scientific name +3426765 | Begomovirus deinbolliae | | scientific name +3426792 | Begomovirus gossypiflavi | | scientific name +3426840 | Begomovirus macroptilicommunis | | scientific name +3426844 | Begomovirus macroptilimusivi | | scientific name +3426850 | Begomovirus malvastrumflavi | | scientific name +3426852 | Begomovirus malvastrumhonghense | | scientific name +3426866 | Begomovirus melochiae | | scientific name +3426867 | Begomovirus melochiaflavi | | scientific name +3426880 | Begomovirus nicotianacubaense | | scientific name +3426899 | Begomovirus pavoniaflavi | | scientific name +3426905 | Begomovirus phaseoligallici | | scientific name +3426918 | Begomovirus ramiis | | scientific name +3426929 | Begomovirus sennae | | scientific name +3426935 | Begomovirus sidaflavachinaense | | scientific name +3426951 | Begomovirus sidamusivi | | scientific name +3426968 | Begomovirus sidavenae | | scientific name +3426987 | Begomovirus solanumburkinafasoense | | scientific name +3426990 | Begomovirus solanumcomorosense | | scientific name +3427005 | Begomovirus solanumflavuscontorsionis | | scientific name +3427008 | Begomovirus solanumflavushuangbaiense | | scientific name +3427013 | Begomovirus solanumflavusmaliense | | scientific name +3427043 | Begomovirus solanumliwaense | | scientific name +3427106 | Begomovirus vincae | | scientific name +3427111 | Begomovirus wissadulaflavi | | scientific name +3427192 | Betacytorhabdovirus hordei | | scientific name +3427224 | Betaendornavirus roselliniae | | scientific name +3427248 | Betapartitivirus cannabis | | scientific name +3427251 | Betapartitivirus fusarii | | scientific name +3427352 | Betasatellite momordicae | | scientific name +3427357 | Betasatellite nicotianasheikhupuraense | | scientific name +3427360 | Betasatellite phaseoli | | scientific name +3427361 | Betasatellite pisi | | scientific name +3427400 | Betasatellite solanipakistanense | | scientific name +3427571 | Botoulivirus botrytidis | | scientific name +3427581 | Botybirnavirus ichi | | scientific name +3427583 | Botybirnavirus ni | | scientific name +3427666 | Bymovirus oryzae | | scientific name +3427713 | Capillovirus alpharibis | | scientific name +3427722 | Capulavirus euphorbiae | | scientific name +3427735 | Carlavirus alphacapsici | | scientific name +3427738 | Carlavirus alphaligustri | | scientific name +3427747 | Carlavirus chisolani | | scientific name +3427752 | Carlavirus deltasambuci | | scientific name +3427755 | Carlavirus epsilonsambuci | | scientific name +3427756 | Carlavirus gammasambuci | | scientific name +3427760 | Carlavirus ipomoeae | | scientific name +3427761 | Carlavirus jasmini | | scientific name +3427773 | Carlavirus latensnerinis | | scientific name +3427788 | Carlavirus pisi | | scientific name +3427841 | Celebovirus lorelli | | scientific name +3427963 | Citiorivirus crordgris | | scientific name +3427967 | Citlodavirus citri | | scientific name +3428012 | Closterovirus tabaci | | scientific name +3428035 | Colecusatellite ageravenachinaense | | scientific name +3428042 | Colecusatellite gossypimultanense | | scientific name +3428104 | Crabreovirus callinectes | | scientific name +3428201 | Deltaflexivirus fusarii | | scientific name +3428207 | Deltapartitivirus duocapsici | | scientific name +3428321 | Dorisivirus aiptaes | | scientific name +3428514 | Enterovirus lesimi | | scientific name +3428669 | Felismacovirus porci4 | | scientific name +3428775 | Fijivirus zeae | | scientific name +3428809 | Foveavirus duoasiaticum | | scientific name +3428880 | Fusagravirus hachi | | scientific name +3428898 | Fusagravirus shichi | | scientific name +3428964 | Gammaricinrhavirus tacheng | | scientific name +3429213 | Hepatovirus bephopi | | scientific name +3429215 | Hepatovirus devoli | | scientific name +3429219 | Hepatovirus hedgi | | scientific name +3429220 | Hepatovirus ishrewi | | scientific name +3429932 | Ilarvirus PrRSV | | scientific name +3429955 | Insevirus ichi | | scientific name +3429963 | Insevirus kyu | | scientific name +3429964 | Insevirus ni | | scientific name +3429978 | Ipomovirus cocciniae | | scientific name +3430566 | Macluravirus dioscoreachinense | | scientific name +3430613 | Maldovirus vitis | | scientific name +3430629 | Mamastrovirus hominis | | scientific name +3430652 | Manawavirus kapowais | | scientific name +3430695 | Mastrevirus bourbonense | | scientific name +3430893 | Mischivirus acombewi | | scientific name +3431044 | Nanovirus flavipisi | | scientific name +3431046 | Nanovirus medicagonis | | scientific name +3431121 | Ninurtavirus duliaris | | scientific name +3431136 | Ninurtavirus procoris | | scientific name +3431208 | Nyfulvavirus nylanderiae | | scientific name +3431242 | Orbivirus chenudaense | | scientific name +3431243 | Orbivirus chobarense | | scientific name +3431256 | Orbivirus wadmedaniense | | scientific name +3431303 | Orthohepadnavirus lagothricis | | scientific name +3431365 | Parahepadnavirus osdeorsi | | scientific name +3431402 | Pasivirus agallia | | scientific name +3431495 | Orthoreovirus mahlapitsiense | | scientific name +3431573 | Penoulivirus phomopsis | | scientific name +3431645 | Phlegivirus ni | | scientific name +3431697 | Pistolvirus ni | | scientific name +3431731 | Polerovirus BVG | | scientific name +3431741 | Polerovirus CPPV1 | | scientific name +3431742 | Polerovirus CPPV2 | | scientific name +3431754 | Polerovirus LABYV | | scientific name +3431756 | Polerovirus MAYMV | | scientific name +3431761 | Polerovirus PABYV | | scientific name +3431814 | Pomovirus colombiense | | scientific name +3431861 | Pospiviroid latensportulacae | | scientific name +3432190 | Rosavirus brorati | | scientific name +3432191 | Rosavirus chewhibe | | scientific name +3432238 | Salisharnavirus mirandaeae | | scientific name +3432239 | Salisharnavirus stewardii | | scientific name +3432269 | Satyrivirus cordulis | | scientific name +3432492 | Sobemovirus ARTVA | | scientific name +3432493 | Sobemovirus BSSV | | scientific name +3432496 | Sobemovirus CYCMV | | scientific name +3432503 | Sobemovirus PLYV | | scientific name +3432505 | Sobemovirus ROMOV | | scientific name +3432511 | Sobemovirus SNMOV | | scientific name +3432521 | Sogarnavirus palmerensis | | scientific name +3432584 | Stangrhavirus wuhan | | scientific name +3432597 | Stoorivirus tarnae | | scientific name +3432787 | Tethyvirus nemileis | | scientific name +3432872 | Tobamovirus fructirugosum | | scientific name +3432893 | Tobamovirus tropici | | scientific name +3432941 | Totivirus hachi | | scientific name +3432943 | Totivirus jyu | | scientific name +3432946 | Totivirus jyuichi | | scientific name +3432948 | Totivirus jyuni | | scientific name +3432950 | Totivirus jyusani | | scientific name +3432951 | Totivirus jyushi | | scientific name +3432953 | Totivirus kyu | | scientific name +3432971 | Totivirus shichi | | scientific name +3432979 | Trichomonasvirus vagiprimus | | scientific name +3433039 | Turncurtovirus rapae | | scientific name +3433064 | Unirnavirus beauveriae | | scientific name +3433066 | Unirnavirus cohigginsiani | | scientific name +3433152 | Velarivirus arecae | | scientific name +3433226 | Victorivirus nijyu | | scientific name +3433229 | Victorivirus nijyuichi | | scientific name +3433231 | Victorivirus nijyuni | | scientific name +3433233 | Victorivirus nijyusani | | scientific name +3433234 | Victorivirus nijyushi | | scientific name +3433265 | Vitivirus phivitis | | scientific name +3433267 | Vitivirus viarracaciae | | scientific name +3433335 | Wamavirus alphacitrulli | | scientific name +3433737 | Bostovirus bovis | | scientific name +3433752 | Alphacoronavirus ferrumequini | | scientific name +3433782 | Alphacoronavirus ricketti | | scientific name +3433784 | Alphacoronavirus nyctali | | scientific name +3433814 | Alphacoronavirus suis | | scientific name +3433816 | Infratovirus hubeiense | | scientific name +3433830 | Potexvirus ecsmanihotis | | scientific name +3433836 | Potexvirus ecsplantagonis | | scientific name +3433853 | Potexvirus marmorsennae | | scientific name +3456997 | Saprolegniomycetes | | scientific name +3456997 | Saprolegniomycetes Thines & Beakes, 2015 | | authority diff --git a/examples/dragen/data/taxdump/nodes.dmp b/examples/dragen/data/taxdump/nodes.dmp new file mode 100644 index 0000000..0dbeed2 --- /dev/null +++ b/examples/dragen/data/taxdump/nodes.dmp @@ -0,0 +1,3599 @@ +1 | 1 | no rank | | 8 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | +2 | 131567 | domain | | 0 | 0 | 11 | 0 | 0 | 0 | 0 | 0 | +543 | 91347 | family | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant +548 | 570 | species | KA | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified +568 | 1903412 | genus | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant +570 | 2890311 | genus | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant +573 | 3390273 | species | KP | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified +574 | 573 | subspecies | KP | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified +1224 | 3379134 | phylum | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1236 | 1224 | class | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant +2157 | 131567 | domain | | 0 | 0 | 11 | 0 | 0 | 0 | 0 | 0 | +2235 | 183963 | order | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant +2759 | 131567 | domain | | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | +2763 | 2759 | phylum | | 4 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +2781 | 31469 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +2806 | 2763 | class | | 4 | 1 | 1 | 1 | 4 | 0 | 0 | 0 | code compliant +2870 | 569578 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +2886 | 2870 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +2887 | 2886 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +2888 | 2887 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3041 | 33090 | phylum | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3166 | 2692248 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3176 | 2684882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3178 | 3176 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3193 | 131221 | clade | | 4 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | +3208 | 3193 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +3214 | 404260 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3296 | 1437180 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant +3297 | 1445963 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3313 | 58019 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3394 | 3297 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3395 | 3394 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3398 | 58024 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3400 | 232347 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3401 | 3400 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3402 | 3401 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3440 | 41768 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3487 | 3744 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3502 | 91835 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3503 | 3502 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3511 | 3503 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3524 | 1437201 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3650 | 71239 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3669 | 1003875 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3744 | 91835 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3745 | 3744 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3764 | 1176516 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3803 | 72025 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3814 | 3803 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3841 | 163735 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4011 | 41937 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4036 | 91882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4037 | 364270 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4055 | 91888 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4143 | 91888 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4149 | 4143 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4199 | 91882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4200 | 4199 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4209 | 91882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4210 | 4209 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4231 | 102814 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4321 | 1802790 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4447 | 1437183 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +4454 | 16360 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4479 | 38820 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4496 | 640623 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4500 | 4496 | species | AL | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +4523 | 1293364 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4581 | 1648004 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4667 | 1437197 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4734 | 1437197 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | +4747 | 73496 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4751 | 33154 | kingdom | | 4 | 0 | 1 | 1 | 4 | 0 | 0 | 0 | code compliant +4762 | 33634 | phylum | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4763 | 3456997 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4764 | 4763 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4769 | 4764 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +4890 | 451864 | phylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +4958 | 766764 | genus | | 4 | 1 | 12 | 1 | 4 | 1 | 0 | 0 | code compliant +4972 | 165440 | species | DH | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +5036 | 299071 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5037 | 5036 | species | HC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +5039 | 229219 | species | BD | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +5125 | 222543 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5139 | 222544 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5149 | 35718 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5197 | 388435 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5198 | 157822 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5199 | 5198 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5204 | 451864 | phylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5234 | 155616 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5302 | 5204 | subphylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5303 | 355688 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5305 | 396331 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5314 | 5317 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5317 | 5303 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5338 | 452333 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5455 | 681950 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5500 | 33184 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5501 | 5500 | species | CI | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +5506 | 110618 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5550 | 34384 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5551 | 5550 | species | TR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +5794 | 33630 | phylum | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5796 | 1280412 | subclass | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5809 | 423054 | family | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5819 | 422676 | order | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5820 | 1639119 | genus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5825 | 418101 | species | PC | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +5857 | 418103 | species | PF | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +5860 | 418101 | species | PV | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +5863 | 422676 | order | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5872 | 5873 | species | TE | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +5873 | 27994 | genus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +5874 | 5873 | species | TA | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +6072 | 33208 | clade | | 1 | 1 | 1 | 1 | 5 | 0 | 1 | 0 | +6073 | 6072 | phylum | | 1 | 1 | 1 | 1 | 4 | 0 | 0 | 0 | code compliant +6101 | 6073 | class | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +6102 | 6101 | subclass | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +6125 | 6102 | order | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +6126 | 123757 | family | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +6127 | 6126 | genus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +6157 | 1206795 | phylum | | 1 | 1 | 1 | 1 | 9 | 0 | 0 | 0 | code compliant +6159 | 166126 | order | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +6199 | 6157 | class | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +6200 | 6199 | subclass | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +6217 | 1206795 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6218 | 6217 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6219 | 6218 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6222 | 6219 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6231 | 1206794 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6236 | 119089 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6249 | 6274 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6267 | 33256 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6274 | 6236 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6447 | 1206795 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6544 | 6447 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6599 | 2785011 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | +6656 | 88770 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6657 | 197562 | subphylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6681 | 2172821 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6682 | 72041 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6683 | 6682 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6692 | 6683 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6712 | 6692 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6738 | 6692 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6744 | 6738 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6745 | 6744 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6746 | 6745 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6752 | 6692 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6960 | 197562 | subphylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6961 | 33339 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6970 | 33341 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6993 | 33341 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +6994 | 6993 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7041 | 33392 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7042 | 71529 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7088 | 85604 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7089 | 37569 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7100 | 37570 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7147 | 33392 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7148 | 7147 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7157 | 41827 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7158 | 1056966 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7399 | 33392 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7400 | 7399 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7401 | 7400 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7402 | 7401 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7434 | 7400 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7458 | 3042114 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7459 | 83321 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7496 | 85512 | subclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7516 | 85817 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7524 | 33342 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7581 | 35070 | order | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +7586 | 33511 | phylum | | 1 | 1 | 1 | 1 | 9 | 0 | 0 | 0 | code compliant +7711 | 33511 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +7742 | 89593 | clade | | 10 | 0 | 1 | 1 | 2 | 1 | 0 | 0 | +7776 | 7742 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +7777 | 7776 | class | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +7778 | 7777 | subclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +7898 | 117571 | superclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +7952 | 186627 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +7953 | 30727 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +7982 | 30725 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +7983 | 278169 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8006 | 41705 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8015 | 8006 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8033 | 504568 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8034 | 8033 | species | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +8035 | 8034 | subspecies | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +8111 | 1489922 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8113 | 1489911 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8205 | 8111 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8219 | 1489878 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8220 | 8219 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8252 | 1489904 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8256 | 30942 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8287 | 117571 | superclass | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant +8292 | 32523 | class | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8293 | 41666 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8294 | 30367 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8295 | 8294 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8306 | 8295 | species | AT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +8342 | 41666 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8416 | 8342 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8426 | 8416 | superfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8427 | 8426 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8457 | 32524 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +8492 | 1329799 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +8782 | 436492 | class | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8825 | 8782 | infraclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8826 | 1549675 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8827 | 8826 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8828 | 8827 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8906 | 3078114 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8936 | 3073810 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8940 | 3073806 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8941 | 8940 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8948 | 3073809 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8949 | 8948 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +8955 | 56259 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9108 | 3078114 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9126 | 3073809 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9219 | 3073810 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9223 | 3073809 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9224 | 9223 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9230 | 3073812 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9231 | 9230 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9239 | 9231 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9263 | 32525 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +9265 | 38605 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9266 | 126287 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9347 | 32525 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +9397 | 314145 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9431 | 30560 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9434 | 9431 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9655 | 3072906 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9671 | 169417 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9672 | 9671 | species | PB | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +9681 | 379583 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9688 | 338153 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9690 | 9688 | species | PO | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +9845 | 91561 | suborder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9895 | 35500 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9918 | 27592 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9975 | 314147 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9979 | 9975 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9980 | 9979 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +9989 | 314147 | order | | 6 | 0 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +10045 | 10066 | subfamily | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +10066 | 337687 | family | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +10239 | 1 | acellular root | | 9 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | +10293 | 3044472 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10294 | 10293 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10319 | 10293 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10357 | 3044472 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10358 | 10357 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10374 | 3044472 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10404 | 2732515 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10405 | 10404 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10442 | 2840070 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10566 | 173087 | species | HP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +10567 | 325456 | species | IX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +10639 | 186534 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10652 | 186534 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10780 | 2732534 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10803 | 40119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10811 | 2732539 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10812 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10814 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +10841 | 2732414 | family | | 3 | 0 | 11 | 0 | 0 | 1 | 0 | 0 | code compliant +10882 | 2946187 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +10892 | 2946186 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +10979 | 2946187 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +10988 | 2946187 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +10989 | 3428775 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +10993 | 2732396 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11006 | 2732540 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11007 | 3152141 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11012 | 2732549 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11050 | 2732545 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11095 | 11050 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11102 | 11050 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11118 | 2499399 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11157 | 2497574 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11158 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11229 | 2560076 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11240 | 3052347 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +11270 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11271 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11308 | 2499411 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11318 | 352235 | species | TD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +11319 | 11318 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +11572 | 1980416 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11582 | 2560289 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +11584 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11617 | 3151839 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11632 | 2169561 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +11974 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12027 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +12030 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +12031 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +12036 | 2560078 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +12050 | 675072 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12051 | 249184 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12058 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12059 | 2960224 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +12091 | 2946633 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12109 | 2946627 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12137 | 2169577 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12141 | 2560077 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +12160 | 69973 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12163 | 1914297 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12174 | 1914298 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12176 | 675064 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12195 | 39729 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12234 | 675071 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12258 | 675075 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12270 | 675075 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12283 | 2732546 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12289 | 2169577 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12316 | 39740 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +12429 | 10239 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +12456 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +12471 | 3432511 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +12701 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +12877 | 12429 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +12929 | 9224 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +13366 | 1156497 | genus | | 4 | 1 | 1 | 1 | 4 | 0 | 0 | 0 | code compliant +13502 | 13366 | species | BN | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +14366 | 1006621 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +16360 | 4447 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant +23461 | 4011 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +24966 | 4055 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +25623 | 1446379 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +25628 | 25623 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +26473 | 216806 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +26867 | 216794 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +27319 | 2916678 | family | | 4 | 1 | 12 | 1 | 4 | 1 | 0 | 0 | code compliant +27337 | 1036719 | species | VD | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +27434 | 33341 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +27483 | 7400 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +27592 | 9895 | subfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +27668 | 9434 | species | ML | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +27708 | 1278288 | species | PC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +27994 | 5863 | family | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +28267 | 11240 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +28725 | 192204 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +28843 | 1224679 | family | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +28890 | 3366610 | phylum | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +29961 | 6712 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +29962 | 116707 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +30092 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +30093 | 38124 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +30102 | 33368 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +30367 | 8293 | superfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +30388 | 8828 | species | CT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +30449 | 3073812 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +30560 | 9397 | suborder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +30725 | 7952 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant +30727 | 7952 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant +30806 | 8205 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +30871 | 1489943 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +30942 | 8252 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +31271 | 5825 | subspecies | PC | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +31370 | 2045258 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +31371 | 31370 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +31468 | 2045261 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +31469 | 31468 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +31612 | 1972589 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +31870 | 2707348 | species | CG | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +32443 | 41665 | infraclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +32519 | 186634 | subcohort | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +32523 | 1338369 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +32524 | 32523 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +32525 | 40674 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +32561 | 8457 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +32613 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +32620 | 3240548 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +33090 | 2759 | kingdom | | 4 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +33154 | 2759 | clade | | 4 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | +33183 | 451871 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +33184 | 33183 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +33208 | 33154 | kingdom | | 1 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +33213 | 6072 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | +33256 | 6249 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +33317 | 33213 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | +33339 | 7496 | infraclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +33340 | 7496 | infraclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +33341 | 33340 | cohort | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +33342 | 33340 | cohort | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +33365 | 1955247 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant +33368 | 33365 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +33372 | 30102 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +33373 | 7524 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +33375 | 33373 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +33392 | 33340 | cohort | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +33415 | 37572 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +33511 | 33213 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | +33554 | 314145 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +33599 | 8940 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +33600 | 33599 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +33601 | 33600 | species | PC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +33630 | 2698737 | clade | | 1 | 0 | 1 | 1 | 4 | 0 | 0 | 0 | +33634 | 2698737 | clade | | 4 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | +34111 | 35466 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +34145 | 131211 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +34384 | 33183 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +34392 | 34384 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +34397 | 5125 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +34448 | 654128 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +34667 | 71528 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +34735 | 7434 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +35069 | 133550 | class | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +35070 | 35069 | subclass | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +35249 | 10374 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +35278 | 439490 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +35300 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +35303 | 11270 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +35323 | 11308 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +35325 | 2559587 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +35342 | 2204151 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +35466 | 35491 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +35491 | 2812636 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +35493 | 33090 | phylum | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +35500 | 9845 | infraorder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +35627 | 2231390 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +35634 | 85819 | parvorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +35709 | 1648008 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +35718 | 5139 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +35740 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +35741 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +35869 | 43951 | species | ZC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +36050 | 569360 | species | FP | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +36291 | 9126 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +37130 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +37567 | 41197 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | +37569 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +37570 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +37572 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +37573 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +37660 | 35627 | species | SH | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +37754 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +37755 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +37756 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +37757 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +37758 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +37759 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +37760 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +37844 | 37945 | subclass | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +37850 | 29961 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +37945 | 6157 | class | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +37960 | 11012 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +38033 | 5149 | species | CG | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +38124 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +38144 | 11050 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +38605 | 9263 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +38820 | 4734 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +38950 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +39249 | 216812 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +39724 | 2732536 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +39725 | 39724 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +39729 | 2732550 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +39731 | 39729 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +39733 | 2732551 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +39734 | 2560072 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +39738 | 2732548 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +39740 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +39750 | 10993 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +39756 | 11006 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +39760 | 2732890 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +39780 | 35325 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +39804 | 2842995 | species | QF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +39829 | 116707 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +39831 | 573 | subspecies | KP | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified +40065 | 3431242 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +40067 | 3431256 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +40068 | 10892 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +40092 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +40093 | 40092 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +40119 | 10780 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +40120 | 10780 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +40122 | 40120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +40272 | 10357 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +40562 | 2982305 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +40588 | 41938 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +40674 | 32524 | class | | 2 | 0 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +40948 | 241792 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +41071 | 7041 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +41073 | 535382 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +41084 | 7041 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +41088 | 41084 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +41154 | 34667 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +41155 | 34667 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +41191 | 7088 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +41196 | 41191 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant +41197 | 41196 | parvorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant +41479 | 2841720 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +41549 | 742010 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +41665 | 186623 | subclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +41666 | 8292 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +41705 | 1489388 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +41768 | 1437183 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +41773 | 41768 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +41827 | 43786 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +41937 | 91836 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +41938 | 91836 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +43358 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +43464 | 8955 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +43786 | 7148 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant +43817 | 7157 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +43951 | 3178 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +44560 | 3426674 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +45234 | 474943 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +45357 | 3303203 | species | CH | 4 | 1 | 12 | 0 | 4 | 1 | 1 | 0 | code compliant; specified +45607 | 45787 | species | WS | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +45787 | 410830 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +45950 | 105711 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +45951 | 45950 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +46108 | 1804622 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +46366 | 241785 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +46569 | 1912919 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +46619 | 3240530 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +47455 | 1648023 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +47456 | 47455 | species | PR | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +47520 | 6599 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +47521 | 47520 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +47522 | 47521 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +47523 | 47526 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +47524 | 2741926 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +47526 | 47522 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +47567 | 6267 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +49188 | 1463140 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +49669 | 50362 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +49817 | 3841 | species | EC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +50292 | 3050258 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +50362 | 4667 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +50435 | 2029065 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +50488 | 6961 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +50489 | 70893 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +50515 | 535378 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +50557 | 6960 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +50713 | 1972572 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +51909 | 9224 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +52123 | 85545 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +52360 | 47524 | species | AP | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +52974 | 1034061 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +52975 | 52974 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +52976 | 52975 | species | BP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +53017 | 11318 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +53058 | 158424 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +53124 | 158330 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +53300 | 156511 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +53541 | 7158 | subgenus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +54049 | 8906 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +54057 | 54049 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +54059 | 54057 | species | SP | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +54354 | 9108 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +54355 | 54354 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +54356 | 54355 | species | AG | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +54357 | 9108 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +54358 | 54357 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +54359 | 54358 | species | PC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +54757 | 5860 | subspecies | PV | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +55136 | 1158979 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant +55193 | 742845 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +55267 | 6159 | suborder | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +55867 | 7042 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +56259 | 2558200 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +56301 | 3073806 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +56302 | 56301 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +56308 | 3073810 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +56309 | 56308 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +56310 | 56309 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +56311 | 56310 | species | TM | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +56342 | 8949 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +56343 | 56342 | species | HC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +56646 | 569360 | species | FV | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +56785 | 28725 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +56866 | 3669 | species | LA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +57379 | 3073810 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +57382 | 8940 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +57383 | 8936 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +57401 | 57382 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +57405 | 57383 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +58019 | 1437180 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +58023 | 3193 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +58024 | 78536 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +58627 | 4958 | species | DF | 4 | 1 | 12 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +59171 | 4200 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +59172 | 59171 | species | PR | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +59500 | 3427666 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +60456 | 3052577 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +60807 | 706622 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +60808 | 60807 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +60809 | 60808 | species | SS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +62020 | 50489 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +62110 | 163733 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +62784 | 70905 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +63225 | 9980 | species | LT | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +63405 | 34392 | species | MC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +64021 | 265963 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +64579 | 65009 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +65009 | 40588 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant +65068 | 3048251 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +65386 | 735337 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +66236 | 35634 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +67753 | 69973 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +67762 | 291027 | species | TL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +68416 | 3431303 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +69720 | 293500 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +69721 | 69720 | species | ZA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +69973 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +70085 | 497679 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +70170 | 702736 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +70439 | 30806 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +70440 | 70439 | species | CW | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +70564 | 70170 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +70778 | 6127 | species | AN | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +70893 | 50488 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant +70905 | 2018325 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +70987 | 7458 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant +71112 | 169417 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +71239 | 91835 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +71240 | 1437183 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +71274 | 1437201 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +71275 | 1437201 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +71528 | 41088 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +71529 | 41088 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant +71950 | 40562 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +72018 | 198625 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +72019 | 72018 | species | SA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +72025 | 91835 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +72041 | 6681 | subclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +72407 | 573 | subspecies | KP | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified +72876 | 29962 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +73275 | 4231 | species | HA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +73496 | 1437197 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +73501 | 45234 | species | CM | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +74132 | 318529 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +74133 | 74132 | species | SA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +74320 | 3047704 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +74649 | 3764 | species | RC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +74694 | 216795 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +75725 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +75739 | 5796 | order | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +75747 | 3427251 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +76717 | 71112 | species | LC | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +76775 | 55193 | species | MR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +76803 | 2499398 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +76804 | 2732506 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +77519 | 418103 | species | PG | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +78060 | 157822 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +78536 | 58023 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | +79078 | 35627 | species | SS | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +79236 | 3426792 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +79514 | 34667 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +79633 | 52123 | species | OT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +79652 | 85545 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +79653 | 79652 | species | OO | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +82582 | 33415 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +82676 | 325461 | species | OX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +83312 | 7459 | species | AN | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +83321 | 70987 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant +83871 | 3052570 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +85103 | 8906 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +85104 | 85103 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +85512 | 50557 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | +85545 | 30449 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +85604 | 33392 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant +85817 | 33392 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant +85819 | 160148 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +85823 | 6970 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +86721 | 3402 | species | MD | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +86989 | 169626 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +86990 | 86989 | species | EH | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +87139 | 55136 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +88159 | 2888 | species | AP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +88770 | 1206794 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | +89593 | 7711 | subphylum | | 10 | 0 | 1 | 1 | 2 | 0 | 0 | 0 | code compliant +90010 | 12059 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +91347 | 1236 | order | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant +91561 | 314145 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +91771 | 9219 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +91776 | 91771 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +91827 | 71240 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +91835 | 71275 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +91836 | 71275 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +91882 | 71274 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +91888 | 71274 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +92738 | 46569 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +93386 | 3050267 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +94231 | 1505891 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +94243 | 1489894 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +94642 | 5809 | genus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +94643 | 94642 | species | BB | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +94844 | 28843 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +94845 | 94844 | species | LI | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 0 | code compliant; specified +95179 | 7100 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +95337 | 11974 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +95341 | 11974 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +98220 | 2888 | species | AC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +98221 | 2888 | species | AM | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +99756 | 37850 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +100182 | 9980 | species | LG | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +100750 | 33415 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +101203 | 4769 | species | SP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +102804 | 4210 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +102805 | 4210 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +102809 | 102804 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +102814 | 911341 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +102818 | 219103 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +103490 | 3511 | species | QG | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +103723 | 327107 | species | GR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +103955 | 56302 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +103956 | 103955 | species | CC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +104430 | 37567 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | +104431 | 37567 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | +104435 | 104430 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +104766 | 251095 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +105711 | 278205 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +106324 | 47567 | species | CO | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +106325 | 106324 | subspecies | CO | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +106742 | 72876 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +107843 | 50515 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +107924 | 183385 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +110618 | 5125 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +111067 | 6746 | species | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +111670 | 5199 | species | CR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +112415 | 78060 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +113113 | 57379 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +113114 | 113113 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +113115 | 113114 | species | RC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +114658 | 3214 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +115354 | 104435 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +116704 | 6752 | no rank | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | +116707 | 116704 | no rank | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | +117010 | 180950 | species | TC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +117570 | 7776 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +117571 | 117570 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +117574 | 10841 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +117677 | 62784 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +117678 | 473626 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +117776 | 6127 | species | AD | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +117778 | 6127 | species | AY | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +117851 | 117893 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +117893 | 7778 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +119089 | 6231 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +119164 | 2169577 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +119257 | 37569 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +120864 | 7402 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +120865 | 120864 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +121422 | 36291 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +121822 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +121823 | 121822 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +121826 | 30093 | species | TU | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +122260 | 28843 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +122261 | 122260 | species | DI | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 0 | code compliant; specified +123365 | 1489388 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +123366 | 123365 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +123367 | 123366 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +123368 | 123367 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +123369 | 123368 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +123757 | 6125 | suborder | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +124006 | 55867 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +124426 | 34397 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +124960 | 4321 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +126287 | 9265 | subfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant +127916 | 33154 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +128790 | 3047678 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +128818 | 3430566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +129017 | 166052 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +129725 | 1914297 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +130990 | 3417957 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +130991 | 130990 | species | EF | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +131209 | 131221 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +131210 | 2684882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +131211 | 131210 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +131220 | 35493 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +131221 | 35493 | subphylum | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant +131567 | 1 | cellular root | CO | 8 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +133550 | 7586 | clade | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | +135166 | 9219 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +135167 | 135166 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +135168 | 135167 | species | BC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +135425 | 175121 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +135426 | 667167 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +137443 | 3050317 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +137757 | 39729 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +138977 | 9434 | species | MH | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +140052 | 327045 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +144051 | 232795 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +145388 | 34111 | species | MN | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +147100 | 6157 | class | | 1 | 1 | 1 | 1 | 9 | 0 | 0 | 0 | code compliant +147271 | 1293359 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +147366 | 359160 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +147368 | 359160 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +147369 | 147370 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +147370 | 4479 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +147376 | 1648035 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +147377 | 1648035 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +147387 | 1648037 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +147428 | 1648036 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +147537 | 716545 | subphylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +147538 | 716545 | subphylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +147545 | 716546 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +147547 | 716546 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +147550 | 715989 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +150311 | 497220 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +151340 | 2788857 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +151341 | 2732532 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +153135 | 327045 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +153286 | 9434 | species | MN | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +153287 | 9434 | species | MT | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +155616 | 5302 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +155619 | 5302 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +155768 | 65386 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +156152 | 4143 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +156208 | 39729 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +156505 | 106742 | species | CI | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +156511 | 1293059 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +156760 | 9239 | species | SM | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +157270 | 3047843 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +157317 | 294824 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +157777 | 3427788 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +157822 | 5197 | suborder | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +158330 | 4747 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +158332 | 4747 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +158391 | 158332 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +158397 | 158332 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +158424 | 158397 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +159141 | 3052437 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +159150 | 3052437 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +159322 | 9434 | species | MA | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +159325 | 9434 | species | MD | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +159332 | 9434 | species | MO | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +159333 | 9434 | species | MR | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +159335 | 9434 | species | MV | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +159337 | 9434 | species | MY | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +160079 | 66236 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +160148 | 1930602 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +160394 | 278171 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +162474 | 1538075 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +163125 | 94243 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +163611 | 319058 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +163725 | 2231387 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +163733 | 2233855 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +163735 | 2233855 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +163739 | 2231385 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +165250 | 157777 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +165440 | 1884640 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +165826 | 3426730 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +166052 | 8427 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +166126 | 147100 | clade | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | +166236 | 55267 | superfamily | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +166243 | 166236 | family | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +166244 | 166243 | subfamily | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +166586 | 53541 | species | AF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +166784 | 8219 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +167449 | 70085 | species | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +168496 | 1503305 | varietas | BA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +168834 | 1895012 | species | PD | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +169417 | 9655 | subfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +169618 | 24966 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +169626 | 169618 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +170325 | 3050251 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +171627 | 5506 | species group | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | +171638 | 3745 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +171788 | 102805 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +171944 | 23461 | species | MS | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +172915 | 2743715 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +172976 | 2781 | species | GL | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +173087 | 333774 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +175121 | 9126 | superfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +175529 | 12929 | species | AG | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +176938 | 57405 | species | CA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +178830 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +178941 | 2218198 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +178948 | 178941 | species | AS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +180252 | 10293 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +180950 | 930979 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +181089 | 135425 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +181124 | 34448 | species | MO | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +181762 | 71950 | species | PC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +182093 | 95337 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +182724 | 155768 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +182725 | 182724 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +183385 | 107843 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +183963 | 2290931 | class | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant +184751 | 1914298 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +185002 | 26867 | species | PO | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +185751 | 3403061 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +185752 | 3403061 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +185753 | 185751 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +185756 | 185751 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +185759 | 185752 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +185786 | 10979 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +186121 | 50435 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +186458 | 178830 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +186534 | 2169561 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +186623 | 7898 | class | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant +186625 | 1489341 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +186626 | 32519 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +186627 | 186626 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant +186634 | 186625 | cohort | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant +186766 | 2732502 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +186767 | 186766 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +186886 | 675071 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +186938 | 3152209 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +187214 | 186534 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +190729 | 1993640 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +192204 | 9126 | superfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +192380 | 79514 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +192381 | 192380 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +192382 | 192381 | species | MA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +193267 | 62020 | species | MT | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +194960 | 2946635 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +195059 | 2748959 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +195633 | 8256 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +195798 | 111670 | subspecies | CR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +197056 | 111670 | subspecies | CR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +197112 | 270256 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +197562 | 197563 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | +197563 | 6656 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | +197613 | 74649 | varietas | RC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +198607 | 1250315 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +198625 | 127916 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +201863 | 11240 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +203261 | 94231 | species | EB | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +205083 | 45951 | species | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +211557 | 211567 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +211558 | 211557 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +211567 | 3039756 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +214437 | 8955 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +215788 | 100750 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +216794 | 156152 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +216795 | 156152 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +216806 | 4149 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +216812 | 4149 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +217160 | 69973 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +219103 | 4210 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +220121 | 53300 | species | MA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +222078 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +222543 | 147550 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +222544 | 147550 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +222556 | 12283 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +223251 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +223286 | 165826 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +223769 | 3047845 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +224510 | 183385 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +225962 | 453050 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +226102 | 49188 | species | AC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +227307 | 687329 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +228457 | 182725 | species | LE | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +228657 | 163739 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +228658 | 228657 | species | EK | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +229219 | 299071 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +231932 | 5305 | species | PC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +232347 | 1437183 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +232795 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +232799 | 699189 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +233784 | 3047850 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +234792 | 172915 | species | SD | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +240201 | 85104 | species | BB | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +241749 | 1729112 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +241750 | 241749 | species | AA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +241751 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +241778 | 4037 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +241780 | 241778 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +241785 | 241778 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +241792 | 241780 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +241932 | 3054905 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +246410 | 5501 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +249184 | 675063 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +249185 | 249184 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +249310 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +249588 | 39733 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +251095 | 2732538 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +252798 | 214437 | species | ST | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +255330 | 453050 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +257883 | 9434 | species | ME | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +260377 | 3427013 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +263002 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +265123 | 291286 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +265963 | 2559587 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +268499 | 37573 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +270256 | 3047819 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +272620 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +274794 | 30871 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +278169 | 7982 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +278171 | 30725 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +278205 | 2908833 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +283494 | 1458186 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +287184 | 115354 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +287195 | 8034 | subspecies | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +290090 | 1195641 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +290849 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +291027 | 10814 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +291286 | 3240527 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +292474 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +292479 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +293500 | 421921 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +294824 | 41155 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +299071 | 33183 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +299368 | 268499 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant +301920 | 2741929 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +301921 | 301920 | species | PP | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +306901 | 38033 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +307635 | 252798 | subspecies | ST | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +310684 | 675072 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +311227 | 2946187 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +311900 | 51909 | species | PR | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +314145 | 1437010 | superorder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +314146 | 1437010 | superorder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +314147 | 314146 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +315357 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +315838 | 27483 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +315840 | 315838 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +318529 | 318559 | tribe | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +318546 | 319095 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +318559 | 319056 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +319056 | 8113 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +319058 | 318546 | tribe | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +319095 | 8113 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +320454 | 74133 | subspecies | SA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +320455 | 74133 | subspecies | SA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +321084 | 43464 | species | CP | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +321263 | 9434 | species | MA | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +323096 | 4581 | species | BV | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +323895 | 35709 | species | CC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +324901 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +325454 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +325455 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +325456 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +325459 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +325461 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +327045 | 11632 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +327107 | 249185 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +327375 | 12163 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +327387 | 3432893 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +327770 | 94231 | species | ET | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +328429 | 119164 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +328527 | 2743716 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +329860 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +330383 | 249184 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +333774 | 151340 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +333921 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +333938 | 333774 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +334425 | 270256 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +334873 | 163125 | species | PC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +336476 | 232799 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +336633 | 144051 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +336635 | 232795 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +336987 | 3426880 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +337052 | 325454 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +337687 | 1963758 | clade | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +338153 | 9681 | subfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +339076 | 53058 | species | CP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +341117 | 7983 | species | MB | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +341128 | 160394 | species | BN | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +344417 | 39750 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +345249 | 39725 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +346391 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +347957 | 140052 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +351425 | 129725 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +351426 | 3428809 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +351428 | 351425 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +352235 | 35323 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +352926 | 39733 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +352927 | 67753 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +353154 | 5874 | strain | | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +353769 | 153135 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +354837 | 2839668 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +355688 | 155619 | no rank | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +357852 | 40948 | species | AL | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +358814 | 121422 | species | PA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +359160 | 4479 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +359505 | 46366 | species | BA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +361688 | 2609695 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +364270 | 4036 | suborder | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant +367188 | 3064797 | genus | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant +367682 | 797075 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +368620 | 64021 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +369752 | 3240498 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +371833 | 95341 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +371917 | 56785 | species | NC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +375141 | 435738 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +375142 | 375141 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +375143 | 375142 | species | CC | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +376274 | 376275 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +376275 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +377833 | 92738 | no rank | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | +379583 | 33554 | suborder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +379584 | 33554 | suborder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +384633 | 9434 | species | MA | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +388435 | 1520881 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +391337 | 260377 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +396331 | 5303 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +397273 | 46108 | species | SM | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +398816 | 336987 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +399178 | 9690 | subspecies | PO | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +399254 | 38124 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +399255 | 399254 | species | AD | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +404260 | 3208 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +404297 | 114658 | superorder | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +405558 | 3240468 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +410297 | 10045 | genus | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +410302 | 410297 | species | GL | 6 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +410830 | 3243772 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +413970 | 39740 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +416867 | 6222 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +416868 | 416867 | species | NG | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +418101 | 5820 | subgenus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +418103 | 5820 | subgenus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +420948 | 87139 | species | AF | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +421010 | 3240544 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +421921 | 4454 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +422676 | 5794 | class | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +423054 | 75739 | suborder | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +423369 | 8034 | subspecies | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +423370 | 8034 | subspecies | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +425264 | 76775 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +427924 | 205083 | subspecies | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +431037 | 40272 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +433372 | 252798 | subspecies | ST | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +435738 | 2072716 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +436486 | 8492 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +436489 | 436486 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +436491 | 436489 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +436492 | 436491 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +437064 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +437489 | 2555566 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +437490 | 437489 | species | SA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +439490 | 2585030 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +441227 | 473626 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +441892 | 2888 | species | AC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +442243 | 215788 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +442302 | 2960910 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +442316 | 82582 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +445316 | 72876 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +446318 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +447093 | 5037 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +450882 | 25628 | species | TF | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +451864 | 4751 | subkingdom | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +451871 | 147545 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +452284 | 5204 | subphylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +452333 | 155619 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +453050 | 3240525 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +456398 | 445316 | species | PS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +461132 | 442243 | species | LL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +464095 | 2732506 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +464925 | 464095 | no rank | | 11 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured +469369 | 475327 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +473626 | 117677 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +473674 | 473713 | subspecies | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +473713 | 117678 | species | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +473783 | 39734 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +473784 | 3048236 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +474943 | 5125 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +475272 | 475327 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +475273 | 475272 | species | EM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +475327 | 7089 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +475347 | 119257 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +475348 | 475347 | species | PF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +478825 | 12058 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +481315 | 3050304 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +484021 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +485724 | 3052579 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +490134 | 68416 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +493796 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +493797 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +493798 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +493799 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +493800 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +493801 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +493802 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +494651 | 3052771 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +497220 | 8220 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +497679 | 8220 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +498257 | 27337 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +501251 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +501252 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +504568 | 8015 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +516546 | 41549 | species | CJ | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +526119 | 249588 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +535378 | 41071 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +535382 | 41071 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +535600 | 10780 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +538002 | 73501 | varietas | CM | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +547124 | 311227 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +547455 | 147271 | species | PV | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +548681 | 2731363 | order | | 9 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | code compliant +548688 | 10374 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +552816 | 99756 | species | EL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +554155 | 63405 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +558016 | 10442 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +558017 | 10442 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +558690 | 352927 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +559297 | 5039 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +559298 | 1681229 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +559305 | 5551 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +560253 | 112415 | species | LL | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +564644 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +569360 | 5506 | species group | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +569578 | 2696291 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +570949 | 1250315 | species | CM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +570950 | 1250315 | species | CM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +578617 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +584378 | 41154 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +585893 | 2732549 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +590647 | 3052353 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +590745 | 353769 | species | MM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +626155 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626156 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626157 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626158 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626159 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626160 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626161 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626162 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626163 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626164 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626165 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626166 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626167 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626168 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626169 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626170 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626171 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626172 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626173 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626174 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626175 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626176 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626177 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626178 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626179 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626180 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626181 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626182 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626183 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626184 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626185 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626186 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626187 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626188 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626189 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626190 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626191 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626192 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626193 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626194 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626195 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626196 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626197 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +626198 | 37130 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +632743 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +640623 | 1652080 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +642248 | 39724 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +642994 | 442316 | species | HM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +644269 | 31371 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +645133 | 31870 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +649996 | 3427005 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +650164 | 231932 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +652723 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +652811 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +652812 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +652813 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +652814 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +652815 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +652816 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +652817 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +652818 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +652819 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +652820 | 35740 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +654128 | 2982316 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +667127 | 39831 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +667151 | 135426 | species | DC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +667167 | 175121 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +667516 | 38144 | species | NV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +667725 | 72019 | strain | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | +674952 | 3152147 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +674953 | 3432979 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +674981 | 3152147 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +674996 | 291027 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +675063 | 2732461 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +675064 | 675063 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +675068 | 675063 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +675071 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +675072 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +675073 | 675072 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +675074 | 464095 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +675075 | 675072 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +675845 | 1980412 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +676044 | 3426852 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +676058 | 6127 | species | AR | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +681501 | 241932 | species | TC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +681950 | 1028384 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +685445 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +685899 | 3432503 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +686565 | 10841 | subfamily | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant +686982 | 2946630 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +687091 | 299368 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +687329 | 3420546 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +687332 | 687329 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +687339 | 687329 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +687387 | 3048408 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +693996 | 2501931 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +693997 | 3433814 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +695850 | 101203 | strain | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | +696855 | 11974 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +699189 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +702736 | 3050262 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +703582 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +706525 | 82676 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +706526 | 1513275 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +706527 | 1513252 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +706622 | 41073 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +706663 | 7581 | family | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +707741 | 706663 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +715989 | 716546 | clade | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +716545 | 4890 | clade | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +716546 | 147538 | clade | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +735337 | 6599 | infraclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +735504 | 325455 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +742010 | 102818 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +742845 | 162474 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +742914 | 39724 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +748365 | 2721536 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +748366 | 748365 | species | AL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +753343 | 287184 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +759124 | 1231296 | species | BY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +759804 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +763898 | 157317 | species | AS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +766764 | 2916678 | family | | 4 | 1 | 12 | 1 | 4 | 1 | 0 | 0 | code compliant +796900 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +796901 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +796902 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +796903 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +796904 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +796905 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +796906 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +796907 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +796908 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +796909 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +796910 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +797075 | 3427773 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +861365 | 39831 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +861561 | 3240517 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +871765 | 687387 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +885375 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +885376 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +886583 | 102809 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +906906 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +906907 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +906908 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +906909 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +906910 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +906911 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +906912 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +906913 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +908833 | 186767 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +908834 | 908833 | species | GA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +911341 | 102804 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +930979 | 2982303 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +935296 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +935650 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +936057 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +936058 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +938257 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +939922 | 674981 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +940834 | 1513253 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +941259 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +943329 | 40948 | species | AL | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +944994 | 3426677 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +977912 | 222556 | species | OV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +983644 | 73501 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +988644 | 439490 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +990925 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +992212 | 2748958 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +994805 | 9266 | species | DP | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +997078 | 3426990 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1003875 | 3650 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1005902 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1005903 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1005904 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1006621 | 158391 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1028307 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1028384 | 222543 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +1032459 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1032460 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1032461 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1032462 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1032463 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1032464 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1032465 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1032466 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1033976 | 3052581 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1033978 | 1028384 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +1034061 | 404297 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1035782 | 129017 | species | MM | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1036719 | 1033978 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +1037890 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1037908 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1046402 | 3427747 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1048227 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1048228 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1048229 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1048230 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1048231 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1048232 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1048233 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1048436 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1048668 | 3428042 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1048854 | 3052665 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1049565 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1049657 | 85823 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +1050903 | 3428207 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1054649 | 3433064 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1056880 | 4523 | species | NM | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1056966 | 43817 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +1070324 | 1513273 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1070408 | 1513260 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1070409 | 1513256 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1070410 | 1513261 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1070413 | 1513256 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1070417 | 1513262 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1071164 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1073966 | 686982 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1074486 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1075431 | 163611 | species | AG | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1077831 | 186766 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1077832 | 1077831 | species | PI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1080004 | 171788 | species | FS | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1080924 | 120865 | species | ZC | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1087440 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1087441 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1087442 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1087443 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1087444 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1087445 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1087446 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1087447 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1094167 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1094168 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1094169 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1094170 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1094171 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1096141 | 3052771 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1111709 | 699189 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1112098 | 79653 | subspecies | OO | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1114942 | 3428669 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1115383 | 3395 | species | CS | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1115692 | 3427248 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1123862 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1124990 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1125630 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1128946 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1128947 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1128948 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1128949 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1128950 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1128951 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1128952 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1128953 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1128954 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1132022 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1133751 | 3432492 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1136133 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1136150 | 39249 | species | SC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1156497 | 3243775 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +1156769 | 1298633 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1158979 | 117851 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant +1159556 | 124426 | species | UV | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +1159795 | 205083 | subspecies | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1159796 | 205083 | subspecies | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1159798 | 205083 | subspecies | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1162296 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1162297 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1168062 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1168063 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1168064 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1170422 | 1307798 | species | LV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1170424 | 1307798 | species | NV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1170425 | 1307798 | species | PV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1170656 | 3427106 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1172985 | 2982806 | species | JT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1173713 | 5314 | species | GS | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +1173763 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1176516 | 171638 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +1177045 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1177046 | 12701 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1177047 | 35300 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1177153 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1182518 | 3430695 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1183241 | 37960 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1185359 | 371833 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1185418 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1185419 | 1460422 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1185420 | 1460422 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1187973 | 2960910 | species | OP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1188990 | 861561 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1193292 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1195163 | 413970 | species | AA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1195641 | 3426935 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1195776 | 195633 | species | PJ | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1196387 | 644269 | species | KM | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +1196474 | 41479 | species | AF | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1196494 | 41479 | species | AP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1199150 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1200970 | 2050584 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1200971 | 2010320 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1202142 | 3427967 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1203539 | 1208309 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1203544 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1203545 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1203546 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1203547 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1205678 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1206794 | 33317 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | +1206795 | 2697495 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | +1208309 | 1891715 | species | DD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1209932 | 2707335 | species | CS | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +1212766 | 1460422 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1213620 | 3051989 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1214274 | 166586 | subspecies | AF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1214275 | 166586 | subspecies | AF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1214955 | 2844804 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1216472 | 1678146 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1217821 | 3052256 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1218098 | 574 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1219210 | 73501 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +1221206 | 291027 | species | SC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1221208 | 3052258 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1221437 | 3433265 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1221521 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1223561 | 3052724 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1223562 | 3052723 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1224679 | 6200 | order | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +1225181 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1225182 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1225183 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1226115 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1226680 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1228988 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1230847 | 186121 | species | MA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1231296 | 283494 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1231522 | 3303203 | species | CD | 4 | 1 | 12 | 0 | 4 | 1 | 1 | 0 | code compliant; specified +1231523 | 45357 | varietas | CH | 4 | 1 | 12 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +1232392 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1232637 | 10293 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1233522 | 696855 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1236101 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1236102 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1236400 | 1723728 | species | PT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1236676 | 2810354 | species | IU | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1238886 | 675073 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1239565 | 3430629 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1241370 | 3426670 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1241918 | 222556 | species | LB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1244085 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1248396 | 1513263 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1249508 | 11102 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1250315 | 12877 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1250520 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1263871 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1267897 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1268974 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1269006 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1272960 | 1972597 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1273128 | 3427357 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1274605 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1274606 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1274607 | 37130 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1274608 | 37130 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1274609 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1274610 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1274611 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1274613 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1274614 | 35741 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1274615 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1276652 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1276653 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1278288 | 2743705 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +1279040 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1279099 | 2955836 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | +1280412 | 5794 | class | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +1284787 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284788 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284789 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284790 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284791 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284792 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284793 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284794 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284795 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284796 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284797 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284798 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284799 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284800 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284801 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284802 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284803 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284804 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284805 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284806 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284807 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284808 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284809 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284810 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284811 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284812 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284813 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284814 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284815 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284816 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284817 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284818 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284819 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284820 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284821 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284822 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284823 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284824 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284825 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284826 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284827 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284828 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284829 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284830 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284831 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284832 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284833 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1284834 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1285372 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1285373 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1285596 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1285597 | 1285596 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1290996 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1292273 | 166244 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +1293059 | 39829 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +1293356 | 1648033 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1293359 | 1293356 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1293364 | 147428 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1294138 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1294139 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1294140 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1294141 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1294269 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1298631 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1298633 | 194960 | species | KC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1299309 | 2560077 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1300166 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1300981 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300982 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300983 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300984 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300985 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300986 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300987 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300988 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300989 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300990 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300991 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300992 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300993 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300994 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300995 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300996 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300997 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300998 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1300999 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301000 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301001 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301002 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301003 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301004 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301005 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301006 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301007 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301008 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301009 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301010 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301011 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301012 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301013 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301014 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1301015 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1302145 | 181089 | species | AG | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1303385 | 3427043 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1304916 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1304917 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1304918 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1304919 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1304920 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1304921 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1304922 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1304923 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1304924 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1306546 | 2022857 | species | CM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1306950 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1307798 | 35278 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1307799 | 11050 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1307958 | 3427760 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1308539 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1308684 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1308685 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1308686 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1308687 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1308688 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1308731 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1308858 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1309536 | 107924 | species | PO | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1310158 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1310159 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1310424 | 37960 | species | VD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1315262 | 1513265 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1316582 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1316938 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1316939 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328324 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328325 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328337 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328362 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328363 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328364 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328366 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328367 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328368 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328369 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328370 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328371 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328372 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328373 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328375 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328377 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328378 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328379 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328380 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328381 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328382 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328383 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328384 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328385 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328386 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328387 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328388 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328389 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328390 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328391 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328392 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328393 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328394 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328396 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328398 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328399 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328400 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328401 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328402 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328403 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328404 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328405 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328406 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328407 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328408 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328409 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328410 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328411 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328412 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328413 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328414 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328415 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328416 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328417 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328418 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328419 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328420 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328421 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328423 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328424 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328425 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328426 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1328427 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1329649 | 1507402 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1329799 | 32561 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +1329801 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1329843 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1331744 | 3433836 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1335476 | 2170170 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1335477 | 2170171 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1338369 | 8287 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +1341693 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1343063 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1343920 | 1914295 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1345628 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1345631 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1348659 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1352932 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1352933 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1357295 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1365186 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1379687 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1379688 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1379689 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1380111 | 473713 | subspecies | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1380456 | 473713 | subspecies | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1380908 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1381121 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1382995 | 3052702 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1384549 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1384550 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1385657 | 686565 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1387562 | 33184 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +1387563 | 1387562 | species | OO | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +1389422 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1392499 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1392500 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1393935 | 138977 | subspecies | MH | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1393936 | 138977 | subspecies | MH | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1395574 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1395575 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400138 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400139 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400140 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400141 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400142 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400143 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400144 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400145 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400160 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400161 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400162 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400163 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400164 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400165 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400166 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400167 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400168 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400169 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400170 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400172 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400173 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400174 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400175 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400176 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400177 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400178 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400179 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400180 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400181 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400182 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400183 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400184 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1400185 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1401779 | 2768478 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +1406314 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1409961 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1409962 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1409963 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1409964 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1409965 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1409966 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1411646 | 573 | isolate | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1413252 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1413253 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1414655 | 3052569 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1414807 | 315840 | species | PC | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1415246 | 354837 | species | CM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1416941 | 34145 | species | CB | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1417983 | 72407 | isolate | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1418810 | 119257 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +1418811 | 1418810 | species | MH | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1420012 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1420013 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1424547 | 147271 | species | PP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1427476 | 2788865 | species | CV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1427522 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1428763 | 40068 | species | TO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1431455 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1432547 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1432550 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1432552 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1432553 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1432554 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1432558 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1432561 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1432563 | 3432505 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1434070 | 2169886 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1435450 | 473783 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1436892 | 3431044 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1437010 | 9347 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +1437180 | 58024 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | +1437183 | 3398 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | +1437197 | 4447 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant +1437201 | 91827 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +1438697 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438698 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438699 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438701 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438702 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438703 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438704 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438705 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438706 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438707 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438708 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438709 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438710 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438711 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438712 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438713 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438714 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438715 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438716 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438717 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438718 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438719 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438720 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438721 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438722 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438723 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438724 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438725 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438726 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438727 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438728 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438729 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438730 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438731 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438732 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438733 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438734 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438735 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438736 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438737 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438738 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438739 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438740 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438741 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438742 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438743 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438744 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438745 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438746 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438747 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438748 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438749 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438750 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438751 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438752 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438753 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438754 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438755 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438756 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438757 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438758 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438759 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438760 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438761 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438762 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438763 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438764 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438765 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438766 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438767 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438768 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438769 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438770 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438771 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438772 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438773 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438774 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438775 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438776 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438777 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438778 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438779 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438780 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438781 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438782 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438783 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438784 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438785 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438786 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438787 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438788 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438789 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438790 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438792 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438793 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438794 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438795 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438796 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438797 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438798 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438800 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438802 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438803 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438804 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438805 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438806 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438807 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438808 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438809 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438810 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1438811 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1439320 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1439321 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1439322 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1439323 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1442610 | 257883 | subspecies | ME | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1445963 | 3296 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1446379 | 2821351 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1449984 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1449985 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1451263 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1451298 | 160079 | species | AD | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1452516 | 1298633 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1453155 | 753343 | species | HR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1453426 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1454021 | 3431136 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1454022 | 3430652 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1454023 | 3431121 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1454024 | 3427841 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1454025 | 3432597 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1454026 | 35342 | species | DL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1454027 | 35342 | species | DL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1454028 | 35342 | species | DL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1454029 | 35342 | species | DL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1454030 | 3427963 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1454227 | 3428035 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1455602 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1455603 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1455604 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1455605 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1457165 | 1307798 | species | WV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1457322 | 3052666 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1457503 | 62110 | species | DA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1458186 | 3403061 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1460422 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1461176 | 41773 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1462681 | 3431761 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1462682 | 3431754 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1462708 | 56866 | varietas | LA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1462709 | 56866 | varietas | LA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1463138 | 3440 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1463140 | 1463138 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1463147 | 1463138 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1463675 | 57401 | species | CB | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1471299 | 3047854 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1476584 | 3047783 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1481465 | 1238886 | species | TN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1484106 | 3137121 | species | AT | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1489341 | 32443 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +1489388 | 186625 | cohort | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant +1489872 | 123369 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | +1489875 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +1489878 | 1489875 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +1489885 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +1489894 | 1489885 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +1489904 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +1489908 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +1489910 | 1489908 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +1489911 | 1489910 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +1489922 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +1489943 | 8111 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +1497848 | 39756 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1503289 | 2501927 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1503291 | 2501928 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1503292 | 2501926 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1503293 | 2691594 | species | BX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1503305 | 26473 | species | BA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1504569 | 3426258 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1504732 | 944994 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1505891 | 274794 | tribe | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +1506574 | 40119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1507401 | 40119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1507402 | 1507401 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1507725 | 1231296 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1510155 | 93386 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1511771 | 2946640 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1511775 | 2946635 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1511778 | 2946627 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1511779 | 3430893 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1511782 | 2946640 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1511783 | 3431402 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1511784 | 1511783 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1511804 | 2946635 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1511809 | 37960 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1511810 | 11012 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1511860 | 2732549 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1511911 | 40119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1513238 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1513243 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1513244 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1513246 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1513252 | 1513243 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1513253 | 1513244 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1513256 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1513260 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1513261 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1513262 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1513263 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1513265 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1513273 | 333921 | species | XX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1513275 | 936058 | species | UX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1513294 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1513308 | 69973 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1520881 | 147547 | clade | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | +1529392 | 3052730 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1534549 | 1511775 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1535266 | 1542665 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1537102 | 5872 | strain | | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | +1537975 | 1978543 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1538075 | 452284 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +1542665 | 1231296 | species | MY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1542744 | 1910928 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1548713 | 186458 | species | OA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1548718 | 1548713 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1548720 | 186458 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1548722 | 186458 | species | OA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1549198 | 311900 | subspecies | PR | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1549675 | 8825 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +1549864 | 2034996 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1550518 | 1972596 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1554466 | 584378 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +1562068 | 1902501 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1563660 | 3048345 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1565088 | 3433066 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1566705 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +1566718 | 1566705 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +1567544 | 171627 | species | FT | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +1569052 | 327375 | species | EC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1569053 | 327375 | species | EC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1569054 | 2169801 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1569055 | 2169802 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1569056 | 2169803 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1569258 | 2734409 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1573459 | 1747648 | species | RN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1577137 | 2845625 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1585420 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +1592764 | 1987744 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1602124 | 3432496 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1603563 | 35740 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1603564 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1604871 | 90010 | species | YE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1604875 | 1891741 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1606764 | 12109 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1606765 | 1606764 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1608041 | 2843859 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608042 | 2845619 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608044 | 2845620 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608045 | 2845621 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608047 | 3052520 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608048 | 3052800 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1608049 | 3426277 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1608058 | 1884461 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608060 | 3052756 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608063 | 2501942 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608064 | 35303 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1608065 | 2845713 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608066 | 2846195 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608067 | 2846193 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608068 | 3052749 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608072 | 988644 | species | SB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1608075 | 3052748 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608083 | 3052536 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608085 | 35303 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1608086 | 2845639 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608087 | 2845621 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1608088 | 2501945 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608089 | 3428964 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1608090 | 3426285 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1608091 | 1977105 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608093 | 2843935 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608094 | 3052540 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608095 | 3052826 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608097 | 3052553 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608100 | 35303 | species | WA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1608101 | 3052632 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608102 | 2844095 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608104 | 2846668 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608105 | 2844861 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608107 | 3052827 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608109 | 2734386 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608110 | 2734387 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608111 | 2734388 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608112 | 35303 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1608114 | 2845539 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608119 | 1978541 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608123 | 2844833 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608126 | 3052554 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608127 | 3052543 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608133 | 2844037 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608134 | 3432584 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1608137 | 2846667 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608138 | 2845626 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608139 | 3052248 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608141 | 1884460 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608144 | 3052212 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608146 | 1978539 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1608533 | 3429955 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1609290 | 3427400 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1611877 | 2734433 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1615583 | 182093 | species | VF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1615758 | 3052522 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1620892 | 2734371 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1622024 | 347957 | species | DR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1628834 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1629665 | 2956585 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | +1629666 | 2955770 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | +1629667 | 2956586 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | +1629671 | 988644 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1631554 | 1986112 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1634381 | 1723728 | species | SP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1639119 | 5819 | family | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +1640277 | 2788865 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1642018 | 3051977 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1642515 | 3048458 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1646350 | 198607 | species | TV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1647924 | 735504 | species | HP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1648004 | 147376 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1648008 | 147376 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1648023 | 147377 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1648033 | 147369 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +1648035 | 147366 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +1648036 | 147369 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +1648037 | 147368 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +1648481 | 464925 | species | AP | 11 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured +1648482 | 464925 | species | AP | 11 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured +1648483 | 464925 | species | AP | 11 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured +1648484 | 464925 | species | AP | 11 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured +1652080 | 147387 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +1653394 | 11617 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1653395 | 11617 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1654339 | 3427583 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1654355 | 675074 | species | KV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1654357 | 1111709 | species | LJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1654603 | 3433152 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1655644 | 117574 | species | PP | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655645 | 117574 | species | PP | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655646 | 1385657 | species | GB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655647 | 117574 | species | MB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655648 | 117574 | species | MB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655649 | 1385657 | species | GB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655650 | 1385657 | species | GB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655651 | 117574 | species | MB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655652 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655653 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655654 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655655 | 1655647 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +1655656 | 1385657 | species | GF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655657 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655658 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655659 | 1385657 | species | GF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655660 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655661 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1655662 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1658615 | 2748967 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1659219 | 1897731 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1659220 | 1897731 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1661062 | 2955454 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1661063 | 2732549 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1661392 | 344417 | species | VT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1661395 | 1986960 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1661396 | 3433226 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1662272 | 526119 | species | DA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1662286 | 1723728 | species | ME | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1662464 | 1285597 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1663127 | 2219055 | species | PX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1663197 | 328527 | species | GT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1667384 | 2956328 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1667587 | 50292 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1670662 | 3052180 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1670669 | 2788865 | species | LR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1670973 | 2844799 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1670975 | 39780 | species | UV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1671382 | 352926 | species | AE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1675862 | 3047795 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1675864 | 1111709 | species | OI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1675865 | 2560642 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1675866 | 3048442 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1676181 | 117574 | species | CF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1676183 | 117574 | species | CF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1676267 | 1662464 | species | RN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1678003 | 291027 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1678042 | 441227 | species | IM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1678146 | 2948661 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1679172 | 3431243 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1679238 | 2560479 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1679933 | 2955300 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1680130 | 564644 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1681229 | 229219 | species | BG | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified +1682186 | 330383 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1682187 | 330383 | species | VT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1682340 | 2169902 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1685502 | 37960 | species | PD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1685755 | 3432269 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1685953 | 38144 | species | ME | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1688637 | 3240554 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1690666 | 336476 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1690672 | 3431365 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692045 | 3428012 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692107 | 1428763 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1692242 | 3428321 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692243 | 642248 | species | AM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692244 | 642248 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692245 | 642248 | species | CO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692246 | 642248 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692247 | 642248 | species | DS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692248 | 642248 | species | FD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692249 | 642248 | species | FC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692250 | 642248 | species | GS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692251 | 642248 | species | HC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692252 | 642248 | species | HC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692253 | 642248 | species | LS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692254 | 642248 | species | LV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692255 | 642248 | species | MS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692256 | 642248 | species | MS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692257 | 642248 | species | PI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692258 | 642248 | species | PK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692259 | 642248 | species | PS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692260 | 642248 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692261 | 642248 | species | PD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692262 | 642248 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1692263 | 642248 | species | SB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1699094 | 1985375 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1701404 | 1385657 | species | GG | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1701405 | 1385657 | species | GG | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +1705090 | 2670808 | species | LB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1705091 | 2670808 | species | MY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1705092 | 1231296 | species | AC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1705297 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1705841 | 124960 | species | IC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1708248 | 41479 | species | AP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +1708572 | 1987123 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1708653 | 1985405 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1708712 | 2734349 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1711684 | 3426175 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1711685 | 3047382 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1712570 | 3052523 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1712572 | 3052541 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1714362 | 3432941 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1714363 | 3432953 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1714364 | 3432943 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1714366 | 3432946 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1714367 | 3432948 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1714368 | 3432950 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1714370 | 39756 | species | RC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1714570 | 3432493 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1714618 | 12091 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1715288 | 1548720 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1720595 | 3047681 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1721090 | 344417 | species | TA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1723728 | 151341 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1725329 | 3048283 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1729112 | 9126 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +1729141 | 3052606 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1729670 | 3432971 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1736759 | 2010321 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1737345 | 2955369 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1737346 | 2485233 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1737522 | 2006147 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1737523 | 2006148 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1738045 | 10814 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1742594 | 3426866 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1742595 | 3426867 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1742596 | 3426899 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1743411 | 3052366 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1746057 | 35278 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746058 | 35278 | species | BT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746059 | 35278 | species | GM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746060 | 35278 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746061 | 35278 | species | SF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746062 | 35278 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746063 | 2982806 | species | SI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746064 | 35278 | species | SL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746065 | 35278 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746066 | 1249508 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746067 | 2982806 | species | WA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746068 | 2982806 | species | WA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746069 | 35278 | species | WC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746070 | 2982806 | species | WC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746071 | 2982806 | species | WF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746072 | 35278 | species | XC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746073 | 35278 | species | XS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1746074 | 35278 | species | XS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1747648 | 1511809 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1755198 | 1231296 | species | PL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1755467 | 39756 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1755752 | 2955269 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1755785 | 2955271 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1755792 | 2955443 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1756157 | 37960 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1756191 | 3052711 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1756445 | 10567 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1756615 | 939922 | species | UV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1757958 | 79633 | subspecies | OT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1758139 | 3431814 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1758883 | 2844039 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1761477 | 3432872 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1762023 | 2006158 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1763507 | 3052719 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1764085 | 3052685 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1764086 | 3052690 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1765736 | 3433231 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1765754 | 3429964 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1766554 | 693997 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1766557 | 1534549 | species | GP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1766559 | 2080833 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1766828 | 3433039 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1768064 | 1714618 | species | TH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1768874 | 37960 | species | SA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1769780 | 336633 | species | AC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1769949 | 3052037 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1770265 | 12289 | species | EA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1770613 | 3431645 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1770617 | 12174 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1770618 | 3427713 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1774200 | 3426712 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1774276 | 3426179 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1775963 | 3240550 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1776109 | 336635 | species | GD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1776153 | 3052183 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1776177 | 3426172 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1777015 | 3426174 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1777016 | 3432951 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1778558 | 35342 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1778559 | 3432787 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1778560 | 35342 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1778561 | 35342 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1778570 | 361688 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1778571 | 1778570 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1778572 | 361688 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1778573 | 361688 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1778580 | 3048218 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1779340 | 2845835 | no rank | | 9 | 1 | 4 | 0 | 0 | 1 | 1 | 0 | +1780507 | 35249 | species | MG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1781241 | 675074 | species | DP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1788315 | 3052043 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1792583 | 3240568 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1795648 | 675074 | species | PT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1798085 | 3431697 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1802790 | 91888 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1803898 | 2955588 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1804153 | 2560620 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1804154 | 2560621 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1804156 | 2560622 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1804622 | 1804623 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1804623 | 3524 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1805494 | 38144 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1809242 | 675063 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1809767 | 328429 | species | IY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1811230 | 3428104 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1811408 | 2560648 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1812179 | 1233522 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1812308 | 3426765 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1813613 | 675074 | species | PB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1813615 | 1884450 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1815581 | 3426347 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1816484 | 2956587 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | +1816485 | 2956588 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | +1816486 | 2956589 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | +1816487 | 2956590 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | +1816488 | 2956591 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | +1817526 | 3048157 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1819678 | 1231296 | species | CY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1820326 | 2560321 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1821222 | 38144 | species | CF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1821227 | 38144 | species | XA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1822365 | 347957 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1823757 | 2501999 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1825924 | 3431731 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1825931 | 2169738 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1826059 | 2169885 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1826822 | 2956583 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | +1833824 | 1856642 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1833938 | 3433229 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1837089 | 2956547 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | +1840528 | 547124 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1841147 | 1231296 | species | BY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1843734 | 1985426 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1843735 | 1985425 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1843736 | 1985412 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1843737 | 1985377 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1843738 | 1985379 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1843739 | 1985393 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1843740 | 1985376 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1843742 | 1985372 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1843761 | 2844603 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1843773 | 2845922 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1844928 | 3052135 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1848040 | 3060718 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1848042 | 3428898 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1848150 | 2956607 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | +1848151 | 2956608 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | +1848152 | 2955781 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | +1848153 | 2955782 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | +1848169 | 3428880 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1849328 | 90010 | species | EG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1849531 | 908833 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1849532 | 908833 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1849533 | 37960 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1849534 | 75747 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1849535 | 3433234 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1849537 | 2955264 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1849542 | 39780 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1849543 | 2955492 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1849544 | 988644 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1849545 | 988644 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1850906 | 3047737 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1853762 | 3427761 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1853865 | 3427722 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1856030 | 39756 | species | GS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1856031 | 3240497 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1856627 | 908833 | species | PS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1856642 | 3431756 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1857323 | 2613861 | species | TK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1859149 | 3050361 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1859161 | 3433233 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1862127 | 3240463 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1862824 | 1910929 | species | GH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1862825 | 2004962 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1862978 | 185786 | species | EF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1864484 | 3050363 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1868472 | 1770617 | species | YV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1869931 | 687091 | species | EE | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1871153 | 3431208 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1871631 | 1809242 | species | RS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1872710 | 2169864 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1872719 | 2560351 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1873455 | 1914447 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1874267 | 39756 | species | MT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1874886 | 3426918 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1881013 | 3433853 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1882382 | 535600 | species | SO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1882732 | 103956 | subspecies | CC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1884450 | 2219049 | species | HV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1884455 | 2501985 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1884456 | 2501987 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1884458 | 1513294 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1884460 | 1884455 | species | AX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1884461 | 1884456 | species | AA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1884640 | 5234 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +1884832 | 2956541 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1884917 | 1548722 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1884991 | 3426929 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1885248 | 1897087 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1885927 | 2956522 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1885928 | 2169692 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1886606 | 3240485 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1887213 | 337052 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1887214 | 2169878 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1887215 | 2170255 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1887216 | 2169879 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1887217 | 2169881 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1887218 | 333938 | species | BT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1887219 | 2169881 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1888309 | 478825 | species | WB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1888311 | 1809242 | species | BT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1890365 | 3429978 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1890423 | 649996 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1891704 | 37960 | species | SJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1891713 | 151341 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1891714 | 151341 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1891715 | 151341 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1891741 | 1891713 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1895012 | 2976112 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +1897087 | 186458 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1897538 | 1910929 | species | CB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1897731 | 194960 | species | KD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1899219 | 291027 | species | SL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1899566 | 3427738 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1902501 | 3432190 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1902502 | 3432191 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1903340 | 1906179 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1903412 | 91347 | family | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant +1904408 | 2955296 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1904409 | 2955303 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1904410 | 1723728 | species | RH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1904411 | 2955472 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1904439 | 347957 | species | SR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1904880 | 3426844 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1904881 | 3426840 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1904882 | 3426951 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1904883 | 3426968 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1904884 | 3427111 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1906179 | 38144 | species | AF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1906245 | 336476 | species | MV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1906317 | 3430613 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1906668 | 3426850 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1907771 | 3059782 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1908665 | 159332 | subspecies | MO | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1908807 | 1680130 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1908808 | 1680130 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1908811 | 1680130 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1908813 | 1680130 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1910928 | 2732539 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1910929 | 1542744 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1911602 | 2560077 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1912919 | 1049657 | no rank | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | +1913124 | 3431741 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1913125 | 3431742 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1914295 | 1914298 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1914297 | 675068 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1914298 | 675068 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1914447 | 3052624 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1916095 | 79633 | subspecies | OT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1916236 | 1761477 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1918013 | 3152110 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1918014 | 3427581 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1922348 | 2585030 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1922602 | 1922348 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1922604 | 1922348 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1922669 | 1922348 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1922934 | 2508259 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1922938 | 1922348 | species | HM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923351 | 1922348 | species | JT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923697 | 1922348 | species | WC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923716 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923726 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923736 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923737 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923738 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923739 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923740 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923742 | 1922348 | species | WM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923743 | 1922348 | species | WN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923745 | 1922348 | species | WP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923746 | 1922348 | species | WP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923748 | 1922348 | species | WP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923752 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923753 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923754 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923755 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923756 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923757 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923758 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923759 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923761 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923763 | 2560845 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1923764 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923765 | 3429963 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923768 | 1922348 | species | XD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923769 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923770 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923771 | 2507505 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1923772 | 2560846 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1923773 | 2507320 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1923775 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923777 | 2508251 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1923778 | 1922348 | species | ZM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1923781 | 1922348 | species | UP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1928073 | 1401779 | species | MD | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +1929150 | 90010 | species | EA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1930602 | 33342 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +1931113 | 3427361 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1936269 | 336476 | species | HA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1938656 | 1922348 | species | JT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1940252 | 3047706 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1940555 | 431037 | species | MR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1941233 | 2844440 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1941234 | 1941235 | species | TG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1941235 | 1910928 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1941236 | 1910928 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1941237 | 2844569 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1941238 | 1910928 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1941239 | 2844612 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1941435 | 3052705 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1941436 | 3052704 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1941437 | 3052270 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1950126 | 3047760 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1955054 | 3426987 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1955247 | 7524 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +1955493 | 40068 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1955730 | 3052333 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1958777 | 1073966 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1958778 | 336476 | species | BI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1958784 | 2576578 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1958957 | 1250315 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1959930 | 371833 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1961665 | 526119 | species | QH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1961666 | 526119 | species | QH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1961785 | 936057 | species | RX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1961833 | 8941 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +1961834 | 1961833 | species | CA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +1963758 | 9989 | suborder | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +1964372 | 345249 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1965238 | 1111709 | species | PR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1965306 | 1680130 | species | LS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1965344 | 2734294 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1967841 | 2734385 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1970065 | 2169757 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1972572 | 11271 | species | VC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1972589 | 32613 | species | EA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1972596 | 32613 | species | EK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1972597 | 32613 | species | EY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1972700 | 336476 | species | DM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1972716 | 3433267 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1972995 | 328429 | species | TV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1973265 | 3048451 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1977105 | 1884458 | species | CW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1977392 | 3433830 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1978413 | 3433335 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1978532 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1978539 | 1978532 | species | LY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1978541 | 1978532 | species | LW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1978543 | 1978532 | species | LK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1978920 | 2560649 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1980412 | 3151837 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1980415 | 3151839 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1980416 | 3151837 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1980417 | 3151837 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1980418 | 3151839 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1980419 | 3151837 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1980420 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1980421 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1980427 | 675845 | species | EF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1980428 | 675845 | species | ET | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1980429 | 675845 | species | EC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1980430 | 675845 | species | ET | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1980431 | 675845 | species | EI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1980517 | 1980415 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1980538 | 1980417 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1985366 | 1910928 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1985372 | 2844423 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1985375 | 2844429 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1985376 | 2844427 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1985377 | 2844428 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1985379 | 2844441 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1985392 | 2844504 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1985393 | 2844505 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1985405 | 2844518 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1985412 | 2844528 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1985425 | 2844548 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1985426 | 2844550 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1985699 | 3427192 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1986112 | 3433737 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1986190 | 1770265 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1986960 | 1986961 | species | AA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +1986961 | 12058 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +1987123 | 3429213 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1987125 | 3429215 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1987129 | 3429219 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1987130 | 3429220 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1987140 | 1987125 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1987144 | 1987129 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1987145 | 1987130 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +1987744 | 3052163 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +1993640 | 3403061 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2003309 | 3050241 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2003394 | 564644 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2003395 | 564644 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2004962 | 2844585 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2005033 | 1566705 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2006147 | 2955470 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2006148 | 2955468 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2006158 | 1891714 | species | BO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2010320 | 3427360 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2010321 | 3427352 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2018325 | 6994 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2020310 | 1554466 | species | AS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +2021209 | 35300 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2022639 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2022641 | 2022639 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2022857 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2029065 | 7516 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2034996 | 2034997 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2034997 | 2501949 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2038729 | 3431046 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2039307 | 516546 | varietas | CJ | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +2045258 | 2806 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +2045261 | 2806 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +2047826 | 121823 | species | CC | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +2048238 | 2486284 | family | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +2048239 | 2048238 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +2048240 | 2048239 | species | PI | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 0 | code compliant; specified +2050584 | 3426905 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2065824 | 166784 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +2065826 | 2065824 | species | SS | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified +2072024 | 3048204 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2072716 | 6274 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2080833 | 1511771 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2136291 | 1292273 | species | OW | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 0 | code compliant; specified +2169561 | 2732514 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2169567 | 2732535 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2169568 | 675063 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2169569 | 2169568 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2169574 | 2732537 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2169577 | 2732553 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2169595 | 151340 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169596 | 151340 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169609 | 2169567 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2169610 | 2169567 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2169619 | 283494 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2169650 | 2169596 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169663 | 2169574 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2169692 | 2169650 | species | AX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169693 | 3426186 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169726 | 3047715 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2169738 | 3427008 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169757 | 1891714 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2169801 | 3427756 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169802 | 3427752 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169803 | 3427755 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169864 | 3428201 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169878 | 1513238 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169879 | 1513238 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169881 | 1513246 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169885 | 3428514 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169886 | 325459 | species | EX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169902 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2169960 | 3429932 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2170064 | 3431495 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2170103 | 2948924 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2170117 | 2845912 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2170126 | 2845932 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2170132 | 3240474 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2170135 | 3240546 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2170170 | 935650 | species | PX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2170171 | 935650 | species | PX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2170255 | 333921 | species | XX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2172821 | 6657 | superclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2204151 | 12429 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2218011 | 2005033 | species | AU | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +2218046 | 3143224 | species | MP | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +2218050 | 1566718 | species | LM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +2218081 | 3101718 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2218082 | 2218081 | species | AB | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +2218119 | 376274 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2218120 | 2218119 | species | HF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +2218135 | 3101718 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2218136 | 2218135 | species | PG | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +2218198 | 30092 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2219049 | 675074 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2219055 | 675074 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2219250 | 469369 | species | OA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified +2231382 | 2231393 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +2231384 | 2231393 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +2231385 | 2231384 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +2231387 | 2231393 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +2231390 | 163725 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +2231393 | 3814 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +2233855 | 2231382 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +2248770 | 1777016 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2259808 | 3052031 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2290931 | 28890 | clade | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +2315733 | 14366 | species | CB | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified +2485233 | 185759 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2486284 | 37844 | order | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant +2497569 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2497570 | 2497569 | subphylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2497571 | 2497569 | subphylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2497572 | 2497570 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2497574 | 2497570 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2497577 | 2497571 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2499398 | 76804 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2499399 | 76804 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2499403 | 76804 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2499405 | 2497572 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2499407 | 2497574 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2499411 | 2497577 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2499606 | 76803 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2499615 | 2499606 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2499616 | 2499606 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2501926 | 3433752 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2501927 | 3433782 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2501928 | 3433784 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2501931 | 11118 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2501940 | 3151839 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2501942 | 2948893 | species | SG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2501945 | 2948721 | species | GT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2501949 | 2499411 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2501952 | 2499407 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2501968 | 2499405 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2501970 | 1980415 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2501971 | 1980415 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2501976 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2501985 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2501987 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2501994 | 1980416 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2501998 | 1980417 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2501999 | 2509489 | species | TK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2507291 | 2501952 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2507320 | 2599620 | species | XM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2507497 | 2501968 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2507505 | 2507497 | species | YX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2508209 | 2499403 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2508239 | 2508209 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2508240 | 2508209 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2508241 | 2508239 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2508242 | 2508241 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2508243 | 2508240 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2508247 | 2508243 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2508251 | 3433816 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2508258 | 2501940 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2508259 | 2508258 | species | HM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2509479 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2509489 | 2499616 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2509500 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2509503 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2509509 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2509514 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2545470 | 1985699 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2547355 | 1679172 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2547356 | 1679172 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2555566 | 95179 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2558200 | 3073811 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +2559587 | 10239 | realm | RX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560063 | 2732504 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2560069 | 11158 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2560072 | 39738 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560076 | 11158 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2560077 | 39738 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560078 | 39738 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560088 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2560100 | 249310 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2560105 | 2560063 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2560185 | 2560076 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2560194 | 2560069 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2560196 | 1980419 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560218 | 324901 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2560230 | 324901 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2560252 | 1914298 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2560254 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2560289 | 11572 | species | OA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2560321 | 3051377 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560349 | 3047686 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560351 | 3427571 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560371 | 3047722 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560468 | 3050285 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560479 | 2560100 | species | BF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2560568 | 3050310 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560614 | 3048219 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560620 | 3432238 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560621 | 3432521 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560622 | 3432239 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560642 | 3051421 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560648 | 39760 | species | IL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2560649 | 1891715 | species | DS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2560801 | 3050360 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2560845 | 2560088 | species | AX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2560846 | 2560088 | species | AX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2566501 | 124006 | species | CB | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified +2572045 | 1761477 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2576578 | 2560218 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2585030 | 2559587 | no rank | | 9 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | +2585815 | 91776 | species | PH | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified +2599620 | 2507291 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2609695 | 12877 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2613861 | 1980419 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2621980 | 568 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +2622732 | 367188 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | +2654645 | 1761477 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2670808 | 190729 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2684882 | 131209 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +2691594 | 2509509 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2692248 | 3041 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +2696291 | 33634 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +2697495 | 33317 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | +2698737 | 2759 | clade | | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +2707335 | 5455 | no rank | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | +2707348 | 5455 | no rank | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | +2721536 | 7953 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +2731341 | 10239 | realm | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2731342 | 10239 | realm | MX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2731360 | 2731341 | kingdom | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2731361 | 2731360 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2731363 | 2731361 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2732091 | 2731342 | kingdom | | 3 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | +2732092 | 2731342 | kingdom | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732396 | 2559587 | kingdom | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732397 | 2559587 | kingdom | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732405 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732406 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732407 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732408 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732409 | 2732397 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732412 | 2732091 | phylum | | 3 | 1 | 11 | 0 | 0 | 1 | 0 | 0 | +2732413 | 2732412 | class | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +2732414 | 2732413 | order | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +2732415 | 2732092 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732416 | 2732092 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732421 | 2732415 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732422 | 2732415 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732423 | 2732416 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732424 | 2732416 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732458 | 2732405 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732459 | 2732405 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732461 | 2732406 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732462 | 2732406 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732463 | 2732406 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732464 | 2732406 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732498 | 2732407 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732499 | 2732407 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732500 | 2732407 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732502 | 2732498 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732503 | 2732499 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732504 | 2732500 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732505 | 2732408 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732506 | 2732408 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732507 | 2732408 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732514 | 2732409 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732515 | 2732514 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732532 | 2732421 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732533 | 2732421 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732534 | 2732422 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732535 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732536 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732537 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732538 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732539 | 2732424 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732540 | 2732458 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732541 | 2788829 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732543 | 2732461 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732544 | 2732461 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732545 | 2732462 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732546 | 2732464 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732548 | 2788833 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732549 | 2732505 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732550 | 2732507 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732551 | 2732507 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732553 | 2732506 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732890 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2732892 | 2732503 | family | | 9 | 1 | 4 | 0 | 0 | 1 | 0 | 0 | +2733223 | 40120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2733224 | 40120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2733246 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2733248 | 2842408 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2733254 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2733256 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2733291 | 10404 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2733293 | 186534 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2734294 | 1891713 | species | AQ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2734349 | 3427224 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2734371 | 2733246 | species | AI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2734385 | 3426146 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2734386 | 3426109 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2734387 | 3426122 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2734388 | 3426137 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2734409 | 2733254 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2734433 | 11584 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2734594 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2741926 | 47523 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2741929 | 47523 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2743705 | 7953 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +2743714 | 30727 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +2743715 | 2743714 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +2743716 | 2743714 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +2748958 | 2733256 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2748959 | 2733248 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2748967 | 2843481 | species | IP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2756270 | 192382 | subspecies | MA | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified +2768478 | 33372 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2785011 | 6544 | subclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2785015 | 735337 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2788829 | 2732459 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2788833 | 2732463 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2788857 | 2732533 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2788865 | 2732541 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2789204 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +2797651 | 707741 | species | ZC | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant; specified +2810354 | 377833 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2811596 | 224510 | species | IP | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified +2812636 | 3166 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +2821351 | 3313 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | +2839668 | 40093 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +2840056 | 3403061 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2840070 | 2840056 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2841720 | 886583 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +2842243 | 2732407 | class | | 9 | 1 | 11 | 0 | 0 | 1 | 0 | 0 | code compliant +2842247 | 2842243 | order | | 3 | 0 | 11 | 0 | 0 | 1 | 0 | 0 | code compliant +2842313 | 2499407 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842319 | 2842247 | family | | 3 | 0 | 11 | 0 | 0 | 1 | 0 | 0 | code compliant +2842325 | 2499407 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842369 | 3152207 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842407 | 11270 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842408 | 11270 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842542 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842594 | 2842325 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842607 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842620 | 2501952 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842645 | 40120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842680 | 2169574 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842848 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842882 | 2501952 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842921 | 2842313 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842923 | 687329 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842950 | 2560063 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2842995 | 2842319 | genus | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant +2843481 | 2499615 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +2843859 | 2842542 | species | AB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2843935 | 2842594 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844037 | 2842620 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844039 | 2842620 | species | CI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844095 | 1308858 | species | SD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844423 | 1542744 | species | GB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844427 | 1542744 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844428 | 1542744 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844429 | 1542744 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844440 | 1542744 | species | GE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844441 | 1542744 | species | GE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844504 | 1542744 | species | GP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844505 | 1542744 | species | GP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844518 | 1542744 | species | GR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844528 | 1542744 | species | GS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844548 | 1985366 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844550 | 1985366 | species | GM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844569 | 1941236 | species | GE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844585 | 1941236 | species | GH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844603 | 1941236 | species | GS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844612 | 1941238 | species | GE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844799 | 227307 | species | GF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844804 | 227307 | species | GH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844833 | 1308858 | species | SH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2844861 | 2842369 | species | AH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2845539 | 1308858 | species | SL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2845619 | 2507291 | species | MB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2845620 | 2507291 | species | MC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2845621 | 2507291 | species | MD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2845625 | 2507291 | species | MS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2845626 | 2507291 | species | MW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2845639 | 2842882 | species | MA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2845713 | 2842921 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2845835 | 3431573 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2845912 | 2169663 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2845922 | 2169663 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2845932 | 2169663 | species | PR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2846193 | 2842369 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2846195 | 1308858 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2846667 | 2842542 | species | AW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2846668 | 1308858 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2847088 | 3052611 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2847270 | 1902502 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2847522 | 642994 | subspecies | HM | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified +2848317 | 1961785 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2866655 | 9918 | species | BA | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified +2867347 | 64579 | species | VR | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified +2870378 | 1511779 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2871195 | 1902501 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2871196 | 1902501 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2876817 | 64579 | species | VX | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified +2890311 | 543 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +2908833 | 2785015 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | +2914707 | 211558 | species | AF | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified +2916678 | 3239874 | order | | 4 | 1 | 12 | 0 | 4 | 1 | 1 | 0 | code compliant +2927998 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified +2927999 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified +2928000 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified +2928001 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified +2928006 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified +2928007 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified +2928008 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified +2932129 | 53124 | species | PH | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified +2942679 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2942681 | 2732408 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2946186 | 2732541 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2946187 | 2732541 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2946194 | 2942681 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2946627 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2946630 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2946633 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2946635 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2946639 | 3079366 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2946640 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2946790 | 1661063 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2946823 | 1661063 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2946827 | 2946194 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2948661 | 2946639 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2948686 | 2732892 | genus | | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | +2948721 | 2501987 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2948851 | 585893 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2948893 | 2501987 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2948924 | 151341 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2948930 | 2560077 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2948932 | 2732892 | genus | | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | +2948940 | 2732892 | genus | | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | +2955264 | 2946790 | species | AI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955269 | 2946790 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955271 | 2946790 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955296 | 1891713 | species | AM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955300 | 1891713 | species | AR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955303 | 1891713 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955369 | 185756 | species | AL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955443 | 2560100 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955454 | 2946823 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955468 | 1891714 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955470 | 1891714 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955472 | 1891714 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955492 | 2946827 | species | BI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955588 | 3427735 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2955770 | 2948686 | species | DB | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955781 | 2948686 | species | DF | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955782 | 2948686 | species | DF | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2955836 | 2948686 | species | DS | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2956328 | 3431861 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2956522 | 2948924 | species | TS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2956541 | 2948930 | species | TG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +2956547 | 2948932 | species | TR | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2956583 | 2948940 | species | UA | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2956585 | 2948940 | species | UB | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2956586 | 2948940 | species | UB | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2956587 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2956588 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2956589 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2956590 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2956591 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2956607 | 2948940 | species | UF | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2956608 | 2948940 | species | UF | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +2960224 | 2946630 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2960910 | 2948851 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | +2965324 | 49669 | species | PL | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified +2976112 | 1461176 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +2976338 | 153286 | subspecies | MN | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified +2980669 | 159337 | subspecies | MY | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified +2982303 | 5338 | suborder | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +2982305 | 5338 | suborder | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +2982316 | 5338 | suborder | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +2982806 | 38144 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3004043 | 74694 | species | VL | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified +3039755 | 27434 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +3039756 | 3039755 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +3042114 | 34735 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | +3044472 | 548681 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3047382 | 10639 | species | CM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3047678 | 12258 | species | CR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3047681 | 3425826 | species | WC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3047686 | 10652 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3047704 | 558016 | species | AB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3047706 | 10652 | species | BT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3047715 | 10652 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3047722 | 10652 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3047737 | 558016 | species | AC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3047760 | 1911602 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3047783 | 310684 | species | CR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3047795 | 558017 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3047819 | 12141 | species | TM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3047843 | 10652 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3047845 | 12270 | species | NA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3047850 | 12270 | species | ND | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3047854 | 10652 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3048157 | 39734 | species | UI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3048204 | 558017 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3048218 | 12051 | species | MN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3048219 | 12036 | species | LN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3048236 | 39734 | species | UP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3048251 | 12270 | species | NP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3048283 | 1299309 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3048345 | 558016 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3048399 | 687332 | species | BH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3048408 | 687339 | species | IS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3048442 | 558016 | species | AU | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3048451 | 10652 | species | BW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3048458 | 39725 | species | CZ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3050241 | 39725 | species | CB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3050251 | 10319 | species | VC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3050258 | 10358 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3050262 | 1232637 | species | SC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3050267 | 180252 | species | MC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3050285 | 548688 | species | PF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3050304 | 10294 | species | SL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3050310 | 40272 | species | RM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3050317 | 10294 | species | SM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3050360 | 1232637 | species | ST | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3050361 | 3048399 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3050363 | 1507401 | species | BU | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3051377 | 2560194 | species | OJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3051421 | 558016 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3051977 | 2733223 | species | AD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3051989 | 2733256 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052031 | 1507401 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052037 | 1507401 | species | BL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052043 | 1507401 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052135 | 39725 | species | CY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052163 | 742914 | species | CR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052180 | 10803 | species | DS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052183 | 2842645 | species | DH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052212 | 1980420 | species | GY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052248 | 2501976 | species | HW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052256 | 40122 | species | IL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052258 | 40122 | species | IL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052270 | 2169609 | species | KA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052318 | 1653394 | species | MM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052321 | 1653394 | species | MO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052333 | 12051 | species | MP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052347 | 11229 | species | MP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052353 | 2560185 | species | NN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052366 | 2842923 | species | OH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052437 | 11572 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052441 | 11572 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052520 | 1980517 | species | OH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052522 | 1980517 | species | OJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052523 | 1980517 | species | OK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052536 | 1980517 | species | OT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052540 | 1980517 | species | OW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052541 | 1980517 | species | OY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052543 | 1980538 | species | OA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052553 | 1980538 | species | OW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052554 | 1980538 | species | OW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052569 | 2560196 | species | OC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052570 | 2560196 | species | OC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052577 | 2560196 | species | OI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052579 | 2560196 | species | OM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052581 | 2560196 | species | OP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052606 | 1307799 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052611 | 1307799 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052624 | 11095 | species | PS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052632 | 1980421 | species | PW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052633 | 1980421 | species | PW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052665 | 11584 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052666 | 11584 | species | PN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052685 | 11584 | species | PT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052690 | 11584 | species | PZ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052702 | 2169610 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052704 | 2169610 | species | PH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052705 | 2169610 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052711 | 1506574 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052719 | 1506574 | species | PR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052723 | 1653395 | species | RA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052724 | 1653395 | species | RC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052730 | 186938 | species | RC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052748 | 2501994 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052749 | 2501970 | species | SA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052756 | 2501971 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052771 | 1511911 | species | TU | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052800 | 2734594 | species | UH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052813 | 2733293 | species | VC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052826 | 2560254 | species | WP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3052827 | 2501998 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3054905 | 3487 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3058443 | 1172985 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3058444 | 1172985 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3059782 | 2733224 | species | BI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3060718 | 187214 | species | SE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3064797 | 2235 | family | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant +3072906 | 379584 | superfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant +3073806 | 3078114 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +3073808 | 3078114 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +3073809 | 3073808 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +3073810 | 3073808 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +3073811 | 3073808 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +3073812 | 3078114 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +3078114 | 8825 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | +3079366 | 2732543 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3101718 | 376275 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +3118152 | 2621980 | species | HS | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +3137121 | 1463147 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3143224 | 1585420 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant +3151693 | 2497571 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3151837 | 3151693 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3151838 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3151839 | 3151693 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3151840 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3151845 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152106 | 2942679 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152107 | 2732538 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152110 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152116 | 3151840 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152119 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152120 | 3151838 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152124 | 3421323 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152126 | 3151845 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152141 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152142 | 3151838 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152144 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152146 | 3421323 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152147 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152207 | 11270 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152209 | 11158 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152475 | 3152106 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152483 | 3152106 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152501 | 3152107 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152639 | 3152207 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152641 | 3152207 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152653 | 3152116 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152867 | 3152119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152873 | 3152120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152905 | 3152124 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3152926 | 3152126 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3153030 | 3152142 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3153055 | 3152142 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3153067 | 3152144 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3153072 | 3152146 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3239873 | 147537 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +3239874 | 147537 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +3240463 | 12195 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240468 | 12195 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240474 | 12195 | species | PB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240485 | 12195 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240497 | 12195 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240498 | 12195 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240517 | 12195 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240525 | 12195 | species | PD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240527 | 12195 | species | PE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240530 | 12195 | species | PG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240544 | 12195 | species | PH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240546 | 12195 | species | PI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240548 | 12195 | species | PI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240550 | 12195 | species | PJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240554 | 12195 | species | PL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3240568 | 12195 | species | PN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3241188 | 1343920 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3243772 | 3239873 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +3243775 | 3239874 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant +3303203 | 27319 | genus | | 4 | 1 | 12 | 1 | 4 | 1 | 0 | 0 | code compliant +3342348 | 79653 | subspecies | OO | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified +3358290 | 150311 | species | OF | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified +3366610 | 2157 | kingdom | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +3368986 | 2622732 | species | HS | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +3368987 | 2622732 | species | HS | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +3379134 | 2 | kingdom | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +3390273 | 570 | species group | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | +3403061 | 10239 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3412625 | 2732092 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3412723 | 3412625 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3415267 | 2732540 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3417955 | 131220 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3417957 | 3417955 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant +3420546 | 3412723 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant +3421323 | 2732540 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3424890 | 2842408 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3424891 | 2842408 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3424976 | 1511860 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3425084 | 2946186 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3425096 | 11270 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3425105 | 3425096 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3425826 | 12050 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3426109 | 3424890 | species | AA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426122 | 3424890 | species | AB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426137 | 3424890 | species | AG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426146 | 3424890 | species | AL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426172 | 2003394 | species | AC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426174 | 2003394 | species | AE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426175 | 2003394 | species | AF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426179 | 2003394 | species | AH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426186 | 2003394 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426258 | 3425105 | species | AV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426277 | 2842542 | species | AH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426285 | 2842542 | species | AT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426347 | 217160 | species | AT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426670 | 10814 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426674 | 10814 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426677 | 10814 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426712 | 10814 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426730 | 10814 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426765 | 10814 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426792 | 10814 | species | BG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426840 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426844 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426850 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426852 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426866 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426867 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426880 | 10814 | species | BN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426899 | 10814 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426905 | 10814 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426918 | 10814 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426929 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426935 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426951 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426968 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426987 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3426990 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427005 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427008 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427013 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427043 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427106 | 10814 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427111 | 10814 | species | BW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427192 | 3424891 | species | BH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427224 | 2003395 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427248 | 1511809 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3427251 | 1511809 | species | BF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3427352 | 190729 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427357 | 190729 | species | BN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427360 | 190729 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427361 | 190729 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427400 | 190729 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427571 | 2560105 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427581 | 1918013 | species | BI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427583 | 1918013 | species | BN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427666 | 39731 | species | BO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427713 | 12174 | species | CA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427722 | 2022857 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427735 | 12163 | species | CA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427738 | 12163 | species | CA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427747 | 12163 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427752 | 12163 | species | CD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427755 | 12163 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427756 | 12163 | species | CG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427760 | 12163 | species | CI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427761 | 12163 | species | CJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427773 | 12163 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427788 | 12163 | species | CP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427841 | 3152475 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427963 | 3152653 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3427967 | 2842607 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3428012 | 12160 | species | CT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3428035 | 2169619 | species | CA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3428042 | 2169619 | species | CG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3428104 | 3425084 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3428201 | 2169569 | species | DF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3428207 | 1511810 | species | DD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3428321 | 3153030 | species | DA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3428514 | 12059 | species | EL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3428669 | 2842680 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3428775 | 10988 | species | FZ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3428809 | 129725 | species | FD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3428880 | 3152867 | species | FH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3428898 | 3152867 | species | FS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3428964 | 3152639 | species | GT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3429213 | 12091 | species | HB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3429215 | 12091 | species | HD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3429219 | 12091 | species | HH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3429220 | 12091 | species | HI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3429932 | 12316 | species | IP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3429955 | 3152905 | species | II | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3429963 | 3152905 | species | IK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3429964 | 3152905 | species | IN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3429978 | 137757 | species | IC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3430566 | 156208 | species | MD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3430613 | 2842848 | species | MV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3430629 | 249588 | species | MH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3430652 | 3152501 | species | MK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3430695 | 10812 | species | MB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3430893 | 1511778 | species | MA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431044 | 104766 | species | NF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431046 | 104766 | species | NM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431121 | 3152926 | species | ND | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431136 | 3152926 | species | NP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431208 | 2022641 | species | NN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431242 | 10892 | species | OC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3431243 | 10892 | species | OC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3431256 | 10892 | species | OW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3431303 | 10405 | species | OL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431365 | 2733291 | species | PO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431402 | 1511782 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431495 | 10882 | species | OM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | +3431573 | 2842950 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431645 | 3153067 | species | PN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431697 | 3153072 | species | PN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431731 | 119164 | species | PB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431741 | 119164 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431742 | 119164 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431754 | 119164 | species | PL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431756 | 119164 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431761 | 119164 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431814 | 186886 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3431861 | 185753 | species | PL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432190 | 1511804 | species | RB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432191 | 1511804 | species | RC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432238 | 2560218 | species | SM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432239 | 2560218 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432269 | 3152873 | species | SC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432492 | 12137 | species | SA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432493 | 12137 | species | SB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432496 | 12137 | species | SC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432503 | 12137 | species | SP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432505 | 12137 | species | SR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432511 | 12137 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432521 | 2560230 | species | SP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432584 | 3152641 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432597 | 3152483 | species | ST | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432787 | 3153055 | species | TN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432872 | 12234 | species | TF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432893 | 12234 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432941 | 11007 | species | TH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432943 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432946 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432948 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432950 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432951 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432953 | 11007 | species | TK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432971 | 11007 | species | TS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3432979 | 674952 | species | TV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433039 | 1298631 | species | TR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433064 | 3424976 | species | UB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433066 | 3424976 | species | UC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433152 | 1513308 | species | VA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433226 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433229 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433231 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433233 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433234 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433265 | 184751 | species | VP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433267 | 184751 | species | VV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433335 | 2560252 | species | WA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433737 | 2508242 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433752 | 2509479 | species | AF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433782 | 2509500 | species | AR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433784 | 2509503 | species | AN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433814 | 2509514 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433816 | 2508247 | species | IH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433830 | 12176 | species | PE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433836 | 12176 | species | PE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3433853 | 12176 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified +3456997 | 4762 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant diff --git a/examples/dragen/data/test_L001_R1.fq.gz b/examples/dragen/data/test_L001_R1.fq.gz new file mode 100644 index 0000000..766f24b Binary files /dev/null and b/examples/dragen/data/test_L001_R1.fq.gz differ diff --git a/examples/dragen/data/test_L001_R2.fq.gz b/examples/dragen/data/test_L001_R2.fq.gz new file mode 100644 index 0000000..887649e Binary files /dev/null and b/examples/dragen/data/test_L001_R2.fq.gz differ diff --git a/examples/dragen/data/test_L002_R1.fq.gz b/examples/dragen/data/test_L002_R1.fq.gz new file mode 100644 index 0000000..1894abb Binary files /dev/null and b/examples/dragen/data/test_L002_R1.fq.gz differ diff --git a/examples/dragen/data/test_L002_R2.fq.gz b/examples/dragen/data/test_L002_R2.fq.gz new file mode 100644 index 0000000..116da3e Binary files /dev/null and b/examples/dragen/data/test_L002_R2.fq.gz differ diff --git a/examples/dragen/data/test_L003_R1.fq.gz b/examples/dragen/data/test_L003_R1.fq.gz new file mode 100644 index 0000000..6a48ae4 Binary files /dev/null and b/examples/dragen/data/test_L003_R1.fq.gz differ diff --git a/examples/dragen/data/test_L003_R2.fq.gz b/examples/dragen/data/test_L003_R2.fq.gz new file mode 100644 index 0000000..ca55f35 Binary files /dev/null and b/examples/dragen/data/test_L003_R2.fq.gz differ diff --git a/examples/dragen/filegraph.svg b/examples/dragen/filegraph.svg new file mode 100644 index 0000000..990f9ca --- /dev/null +++ b/examples/dragen/filegraph.svg @@ -0,0 +1,1346 @@ + + + + + + +snakemake_dag + + + +0 +target_taxon + +↪ input + +reports/multiqc.taxon.html +reports/multiqc_data.taxon.zip +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz +results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/prefilter_metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz +results/prefilter_reads/saturated/Lib_LVsim1_collapsed.fastq.gz +results/prefilter_reads/saturated/Lib_LVsim1_collapsed.fastq.gz +results/prefilter_reads/saturated/Lib_LVsim2_collapsed.fastq.gz +results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz +results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz +results/reads/saturated/Lib_LVsim2_collapsed.fastq.gz +stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz +stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz +stats/metadmg/damage/Lib_LVsim2_collapsed.stat.gz +stats/prefilter_metadmg/damage/Lib_LVsim1_collapsed.stat.gz +stats/prefilter_metadmg/damage/Lib_LVsim1_collapsed.stat.gz +stats/prefilter_metadmg/damage/Lib_LVsim2_collapsed.stat.gz +   + + + + + + +1 +multiqc_taxon + +↪ input + +/maps/projects/caeg/people/lnc113/workflows/aeDNA/aeDNA/workflow/resources/multiqc_config.yaml +logs/prefilter_shards/dragen/Lib_LVsim1_collapsed.hires_organelles_viruses_smags.1-of-2.log +logs/prefilter_shards/dragen/Lib_LVsim1_collapsed.hires_organelles_viruses_smags.2-of-2.log +logs/prefilter_shards/dragen/Lib_LVsim1_collapsed.human_genome.1-of-1.log +logs/prefilter_shards/dragen/Lib_LVsim2_collapsed.hires_organelles_viruses_smags.1-of-2.log +logs/prefilter_shards/dragen/Lib_LVsim2_collapsed.hires_organelles_viruses_smags.2-of-2.log +logs/prefilter_shards/dragen/Lib_LVsim2_collapsed.human_genome.1-of-1.log +logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.1-of-4.log +logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.2-of-4.log +logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.3-of-4.log +logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.4-of-4.log +logs/shards/dragen/Lib_LVsim1_collapsed.refseq_mitoch.1-of-1.log +logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.1-of-4.log +logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.2-of-4.log +logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.3-of-4.log +logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.4-of-4.log +logs/shards/dragen/Lib_LVsim2_collapsed.refseq_mitoch.1-of-1.log +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz +results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz +results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz +results/metadmg/dfit/Lib_LVsim2_collapsed.dfit.gz +results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/prefilter_metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz +results/prefilter_metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz +results/prefilter_metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz +results/prefilter_metadmg/dfit/Lib_LVsim2_collapsed.dfit.gz +stats/aligns/samtools_stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools_stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools_stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools_stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools_stats/Lib_LVsim2_collapsed.txt +stats/aligns/samtools_stats/Lib_LVsim2_collapsed.txt +stats/prefilter_aligns/samtools_stats/Lib_LVsim1_collapsed.txt +stats/prefilter_aligns/samtools_stats/Lib_LVsim1_collapsed.txt +stats/prefilter_aligns/samtools_stats/Lib_LVsim1_collapsed.txt +stats/prefilter_aligns/samtools_stats/Lib_LVsim1_collapsed.txt +stats/prefilter_aligns/samtools_stats/Lib_LVsim2_collapsed.txt +stats/prefilter_aligns/samtools_stats/Lib_LVsim2_collapsed.txt +stats/reads/fastqc/derep/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/derep/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/low_complexity/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/low_complexity/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/merge_lanes/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/merge_lanes/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/prefilter/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/prefilter/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/prefilter/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L001_R1.html +stats/reads/fastqc/raw/Lib_LVsim1_L001_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L001_R2.html +stats/reads/fastqc/raw/Lib_LVsim1_L001_R2_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L002_R1.html +stats/reads/fastqc/raw/Lib_LVsim1_L002_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L002_R2.html +stats/reads/fastqc/raw/Lib_LVsim1_L002_R2_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim2_L001_R1.html +stats/reads/fastqc/raw/Lib_LVsim2_L001_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim2_L001_R2.html +stats/reads/fastqc/raw/Lib_LVsim2_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_R1.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_R2.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_R1.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_R2.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_R1.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_R2.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton_fastqc.zip +stats/reads/nonpareil/merge_lanes/Lib_LVsim1_collapsed.json +stats/reads/nonpareil/merge_lanes/Lib_LVsim2_collapsed.json +stats/reads/trim/Lib_LVsim1_L001_pe.settings +stats/reads/trim/Lib_LVsim1_L002_pe.settings +stats/reads/trim/Lib_LVsim2_L001_pe.settings + +output → + +reports/multiqc.taxon.html +reports/multiqc_data.taxon.zip + + + + + + +1->0 + + + + + +2 +trim_fastqc_raw + +↪ input + +results/reads/raw/{sample}_{library}_{lane}_{read_type_raw}.fastq.gz + +output → + +stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}.html +stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}_fastqc.zip + + + + + + +2->1 + + + + + +3 +trim_get_fastq_raw + +↪ input + +<input function> + +output → + +results/reads/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}.fastq.gz + + + + + + +3->2 + + + + + +4 +trim_adapterremoval_fastq_pe + +↪ input + +<input function> + +output → + +results/reads/trim/{sample}_{library}_{lane}_R1.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_R2.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_collapsed.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_collapsedtrunc.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_discarded.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_singleton.fastq.gz +stats/reads/trim/{sample}_{library}_{lane}_pe.settings + + + + + + +3->4 + + + + + +4->1 + + + + + +5 +trim_fastqc_trim + +↪ input + +results/reads/trim/{sample}_{library}_{lane}_{read_type_trim}.fastq.gz + +output → + +stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,R1|singleton|collapsedtrunc|R2|collapsed}.html +stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,R1|singleton|collapsedtrunc|R2|collapsed}_fastqc.zip + + + + + + +4->5 + + + + + +7 +derep_merge_lanes + +↪ input + +<input function> + +output → + +temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz + + + + + + +4->7 + + + + + +5->1 + + + + + +6 +derep_fastqc + +↪ input + +<input function> + +output → + +stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}.html +stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}_fastqc.zip + + + + + + +6->1 + + + + + +7->6 + + + + + +9 +derep_nonpareil_infer + +↪ input + +<input function> + +output → + +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.log +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npa +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npc +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo + + + + + + +7->9 + + + + + +10 +derep_seqkit + +↪ input + +temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz + +output → + +stats/reads/derep/{sample}_{library}_{read_type_trim}.dup.tsv +temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz + + + + + + +7->10 + + + + + +8 +derep_nonpareil_plot + +↪ input + +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo + +output → + +reports/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.pdf +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.json +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.tsv + + + + + + +8->1 + + + + + +9->8 + + + + + +10->6 + + + + + +11 +derep_low_complexity + +↪ input + +temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz + +output → + +results/reads/low_complexity/{sample}_{library}_{read_type_trim}.fastq.gz +stats/reads/low_complexity/{sample}_{library}_{read_type_trim}.txt +temp/reads/low_complexity/{sample}_{library}_{read_type_trim}.discarded.fastq.gz + + + + + + +10->11 + + + + + +11->6 + + + + + +13 +prefilter_reads_extract + +↪ input + +<input function> +temp/reads/prefilter/merge/{sample}_{library}_{read_type_map}.read_ids + +output → + +results/reads/prefilter/extract/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.fastq.gz + + + + + + +11->13 + + + + + +20 +taxon_prefilter_shard_dragen + +↪ input + +<input function> +temp/prefilter_shards/dragen/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.csv + +output → + +temp/prefilter_shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + + + + +11->20 + + + + + +21 +taxon_prefilter_shard_dragen_csv + +↪ input + +<input function> + +output → + +temp/prefilter_shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.csv + + + + + + +11->21 + + + + + +28 +taxon_shard_dragen + +↪ input + +<input function> +temp/shards/dragen/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.csv + +output → + +temp/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + + + + +11->28 + + + + + +40 +taxon_prefilter_shard_saturated_reads_extract + +↪ input + +<input function> +temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv + +output → + +results/prefilter_reads/saturated/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.fastq.gz + + + + + + +11->40 + + + + + +42 +taxon_shard_saturated_reads_extract + +↪ input + +<input function> +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv + +output → + +results/reads/saturated/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.fastq.gz + + + + + + +11->42 + + + + + +12 +prefilter_fastqc + +↪ input + +results/reads/prefilter/extract/{sample}_{library}_{read_type_map}.fastq.gz + +output → + +stats/reads/fastqc/prefilter/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.html +stats/reads/fastqc/prefilter/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}_fastqc.zip + + + + + + +12->1 + + + + + +13->12 + + + + + +29 +taxon_shard_dragen_csv + +↪ input + +<input function> + +output → + +temp/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.csv + + + + + + +13->29 + + + + + +14 +prefilter_reads_merge + +↪ input + +temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv +temp/reads/prefilter/taxonomy/{sample}_{library}_{read_type_map}.read_ids + +output → + +temp/reads/prefilter/merge/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.read_ids + + + + + + +14->13 + + + + + +15 +prefilter_reads_taxonomy + +↪ input + +/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/names.dmp +/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/nodes.dmp +data/human.acc2taxid.gz +data/prok.acc2taxid.gz +results/prefilter_aligns/merge/{sample}_{library}_{read_type_map}.bam + +output → + +temp/reads/prefilter/taxonomy/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.read_ids + + + + + + +15->14 + + + + + +16 +taxon_prefilter_align_merge + +↪ input + +<input function> + +output → + +results/prefilter_aligns/merge/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam + + + + + + +16->15 + + + + + +24 +taxon_prefilter_align_stats + +↪ input + +results/prefilter_aligns/merge/{sample}_{library}_{read_type_map}.bam + +output → + +stats/prefilter_aligns/samtools_stats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.txt + + + + + + +16->24 + + + + + +26 +taxon_prefilter_metadmg_lca + +↪ input + +/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/names.dmp +/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/nodes.dmp +<function <lambda> at 0x7fef3af5f060> +data/human.acc2taxid.gz +data/prok.acc2taxid.gz + +output → + +results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz +results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.lca.gz +stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz +stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +16->26 + + + + + +41 +taxon_prefilter_metadmg_damage + +↪ input + +<function <lambda> at 0x7fef3af5f1a0> + +output → + +results/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz +results/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.res.gz +stats/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz +stats/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +16->41 + + + + + +17 +taxon_prefilter_shard_sort_query + +↪ input + +temp/prefilter_shards/unicorn/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam + +output → + +temp/prefilter_shards/sort_query/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + + + + +17->16 + + + + + +18 +taxon_prefilter_shard_unicorn + +↪ input + +temp/prefilter_shards/saturated_reads/remove/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam + +output → + +stats/prefilter_shards/unicorn/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv +temp/prefilter_shards/unicorn/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + + + + +18->17 + + + + + +19 +taxon_prefilter_shard_saturated_reads_remove + +↪ input + +<input function> +temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv + +output → + +temp/prefilter_shards/saturated_reads/remove/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + + + + +19->18 + + + + + +20->1 + + + + + +20->19 + + + + + +23 +taxon_prefilter_shard_count_alns + +↪ input + +<input function> + +output → + +temp/prefilter_shards/count_alns/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv + + + + + + +20->23 + + + + + +21->20 + + + + + +22 +taxon_prefilter_shard_saturated_reads_filter + +↪ input + +temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.hires_organelles_viruses_smags.1-of-2.tsv +temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.hires_organelles_viruses_smags.2-of-2.tsv +temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.human_genome.1-of-1.tsv + +output → + +temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv + + + + + + +22->14 + + + + + +22->19 + + + + + +22->40 + + + + + +23->22 + + + + + +24->1 + + + + + +25 +taxon_prefilter_metadmg_dfit + +↪ input + +/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/names.dmp +/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/nodes.dmp +results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz + +output → + +results/prefilter_metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.boot.stat.gz +results/prefilter_metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.dfit.gz + + + + + + +25->1 + + + + + +27 +taxon_prefilter_metadmg_aggregate + +↪ input + +/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/names.dmp +/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/nodes.dmp +results/prefilter_metadmg/dfit/{sample}_{library}_{read_type_map}.dfit.gz +results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz +stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.stat.gz + +output → + +results/prefilter_metadmg/aggregate/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +25->27 + + + + + +26->25 + + + + + +26->27 + + + + + +27->0 + + + + + +27->1 + + + + + +28->1 + + + + + +34 +taxon_shard_saturated_reads_remove + +↪ input + +<input function> +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv + +output → + +temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + + + + +28->34 + + + + + +36 +taxon_shard_count_alns + +↪ input + +<input function> + +output → + +temp/shards/count_alns/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv + + + + + + +28->36 + + + + + +29->28 + + + + + +30 +taxon_align_stats + +↪ input + +results/aligns/merge/{sample}_{library}_{read_type_map}.bam + +output → + +stats/aligns/samtools_stats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.txt + + + + + + +30->1 + + + + + +31 +taxon_align_merge + +↪ input + +<input function> + +output → + +results/aligns/merge/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam + + + + + + +31->30 + + + + + +38 +taxon_metadmg_lca + +↪ input + +<function <lambda> at 0x7fef3af5fd80> +data/core_nt.acc2taxid.gz +data/mitoch.acc2taxid.gz +data/taxdump/names.dmp +data/taxdump/nodes.dmp + +output → + +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.lca.gz +stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz +stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +31->38 + + + + + +43 +taxon_metadmg_damage + +↪ input + +<function <lambda> at 0x7fef3af5fce0> + +output → + +results/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz +results/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.res.gz +stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz +stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +31->43 + + + + + +32 +taxon_shard_sort_query + +↪ input + +temp/shards/unicorn/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam + +output → + +temp/shards/sort_query/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + + + + +32->31 + + + + + +33 +taxon_shard_unicorn + +↪ input + +temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam + +output → + +stats/shards/unicorn/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv +temp/shards/unicorn/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + + + + +33->32 + + + + + +34->33 + + + + + +35 +taxon_shard_saturated_reads_filter + +↪ input + +temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.1-of-4.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.2-of-4.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.3-of-4.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.4-of-4.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.refseq_mitoch.1-of-1.tsv + +output → + +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv + + + + + + +35->34 + + + + + +35->42 + + + + + +36->35 + + + + + +37 +taxon_metadmg_dfit + +↪ input + +data/taxdump/names.dmp +data/taxdump/nodes.dmp +results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz + +output → + +results/metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.boot.stat.gz +results/metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.dfit.gz + + + + + + +37->1 + + + + + +39 +taxon_metadmg_aggregate + +↪ input + +data/taxdump/names.dmp +data/taxdump/nodes.dmp +results/metadmg/dfit/{sample}_{library}_{read_type_map}.dfit.gz +results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz +stats/metadmg/lca/{sample}_{library}_{read_type_map}.stat.gz + +output → + +results/metadmg/aggregate/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +37->39 + + + + + +38->37 + + + + + +38->39 + + + + + +39->0 + + + + + +39->1 + + + + + +40->0 + + + + + +41->0 + + + + + +42->0 + + + + + +43->0 + + + + + diff --git a/examples/dragen/rulegraph.svg b/examples/dragen/rulegraph.svg new file mode 100644 index 0000000..d9d66a8 --- /dev/null +++ b/examples/dragen/rulegraph.svg @@ -0,0 +1,721 @@ + + + + + + +snakemake_dag + + + +0 + +target_taxon + + + +1 + +multiqc_taxon + + + +1->0 + + + + + +2 + +trim_fastqc_raw + + + +2->1 + + + + + +3 + +trim_get_fastq_raw + + + +3->2 + + + + + +4 + +trim_adapterremoval_fastq_pe + + + +3->4 + + + + + +4->1 + + + + + +5 + +trim_fastqc_trim + + + +4->5 + + + + + +7 + +derep_merge_lanes + + + +4->7 + + + + + +5->1 + + + + + +6 + +derep_fastqc + + + +6->1 + + + + + +7->6 + + + + + +9 + +derep_nonpareil_infer + + + +7->9 + + + + + +10 + +derep_seqkit + + + +7->10 + + + + + +8 + +derep_nonpareil_plot + + + +8->1 + + + + + +9->8 + + + + + +10->6 + + + + + +11 + +derep_low_complexity + + + +10->11 + + + + + +11->6 + + + + + +13 + +prefilter_reads_extract + + + +11->13 + + + + + +20 + +taxon_prefilter_shard_dragen + + + +11->20 + + + + + +21 + +taxon_prefilter_shard_dragen_csv + + + +11->21 + + + + + +28 + +taxon_shard_dragen + + + +11->28 + + + + + +40 + +taxon_prefilter_shard_saturated_reads_extract + + + +11->40 + + + + + +42 + +taxon_shard_saturated_reads_extract + + + +11->42 + + + + + +12 + +prefilter_fastqc + + + +12->1 + + + + + +13->12 + + + + + +29 + +taxon_shard_dragen_csv + + + +13->29 + + + + + +14 + +prefilter_reads_merge + + + +14->13 + + + + + +15 + +prefilter_reads_taxonomy + + + +15->14 + + + + + +16 + +taxon_prefilter_align_merge + + + +16->15 + + + + + +24 + +taxon_prefilter_align_stats + + + +16->24 + + + + + +26 + +taxon_prefilter_metadmg_lca + + + +16->26 + + + + + +41 + +taxon_prefilter_metadmg_damage + + + +16->41 + + + + + +17 + +taxon_prefilter_shard_sort_query + + + +17->16 + + + + + +18 + +taxon_prefilter_shard_unicorn + + + +18->17 + + + + + +19 + +taxon_prefilter_shard_saturated_reads_remove + + + +19->18 + + + + + +20->1 + + + + + +20->19 + + + + + +23 + +taxon_prefilter_shard_count_alns + + + +20->23 + + + + + +21->20 + + + + + +22 + +taxon_prefilter_shard_saturated_reads_filter + + + +22->14 + + + + + +22->19 + + + + + +22->40 + + + + + +23->22 + + + + + +24->1 + + + + + +25 + +taxon_prefilter_metadmg_dfit + + + +25->1 + + + + + +27 + +taxon_prefilter_metadmg_aggregate + + + +25->27 + + + + + +26->25 + + + + + +26->27 + + + + + +27->0 + + + + + +27->1 + + + + + +28->1 + + + + + +34 + +taxon_shard_saturated_reads_remove + + + +28->34 + + + + + +36 + +taxon_shard_count_alns + + + +28->36 + + + + + +29->28 + + + + + +30 + +taxon_align_stats + + + +30->1 + + + + + +31 + +taxon_align_merge + + + +31->30 + + + + + +38 + +taxon_metadmg_lca + + + +31->38 + + + + + +43 + +taxon_metadmg_damage + + + +31->43 + + + + + +32 + +taxon_shard_sort_query + + + +32->31 + + + + + +33 + +taxon_shard_unicorn + + + +33->32 + + + + + +34->33 + + + + + +35 + +taxon_shard_saturated_reads_filter + + + +35->34 + + + + + +35->42 + + + + + +36->35 + + + + + +37 + +taxon_metadmg_dfit + + + +37->1 + + + + + +39 + +taxon_metadmg_aggregate + + + +37->39 + + + + + +38->37 + + + + + +38->39 + + + + + +39->0 + + + + + +39->1 + + + + + +40->0 + + + + + +41->0 + + + + + +42->0 + + + + + +43->0 + + + + + diff --git a/examples/make_dags.sh b/examples/make_dags.sh index 46e2c14..cd48be9 100755 --- a/examples/make_dags.sh +++ b/examples/make_dags.sh @@ -4,7 +4,7 @@ set -euxo pipefail SNAKEMAKE_OPTS="--snakefile ../../workflow/Snakefile --configfile config/config.yaml --software-deployment-method conda --keep-storage-local-copies --forceall $@" -for TEST in euk_prok_virus empty +for TEST in euk_prok_virus empty dragen do cd $TEST/ snakemake $SNAKEMAKE_OPTS --dryrun diff --git a/pixi.toml b/pixi.toml index 8363876..77cf7af 100644 --- a/pixi.toml +++ b/pixi.toml @@ -18,14 +18,14 @@ sqlalchemy-utils = ">=0.42.0,<1" psycopg2 = ">=2.9.10,<3" [environments] -test = { features = ["test"]} +test = { features = ["test"] } format = { features = ["format"], no-default-feature = true } [feature.test.dependencies] -pytest = "*" -graphviz = "*" +pytest = ">=9.0.2" +graphviz = ">=12.2.1" gatk4 = ">=4.0.51,<5" [feature.format.dependencies] -black = "*" -snakefmt = "*" +ruff = ">=0.15.1" +snakefmt = ">=0.11.5" diff --git a/workflow/rules/prefilter.smk b/workflow/rules/prefilter.smk index ed5eea7..ccc7828 100644 --- a/workflow/rules/prefilter.smk +++ b/workflow/rules/prefilter.smk @@ -7,12 +7,12 @@ rule prefilter_reads_taxonomy: acc2taxid=rules.taxon_prefilter_metadmg_lca.input.acc2taxid, output: read_id=temp( - "temp/reads/prefilter/taxonomy/{sample}_{library}_{read_type_map}.read_ids" + "//prefilter/taxonomy/{sample}_{library}_{read_type_map}.read_ids" ), log: - "logs/reads/prefilter/taxonomy/{sample}_{library}_{read_type_map}.log", + "//prefilter/taxonomy/{sample}_{library}_{read_type_map}.log", benchmark: - "benchmarks/reads/prefilter/taxonomy/{sample}_{library}_{read_type_map}.jsonl" + "//prefilter/taxonomy/{sample}_{library}_{read_type_map}.jsonl" params: extra="-taxnames {}".format(config["prefilter"]["taxa"]), conda: @@ -33,12 +33,12 @@ rule prefilter_reads_merge: saturated=rules.taxon_prefilter_shard_saturated_reads_filter.output.read_id, output: read_id=temp( - "temp/reads/prefilter/merge/{sample}_{library}_{read_type_map}.read_ids" + "//prefilter/merge/{sample}_{library}_{read_type_map}.read_ids" ), log: - "logs/reads/prefilter/merge/{sample}_{library}_{read_type_map}.log", + "//prefilter/merge/{sample}_{library}_{read_type_map}.log", benchmark: - "benchmarks/reads/prefilter/merge/{sample}_{library}_{read_type_map}.jsonl" + "//prefilter/merge/{sample}_{library}_{read_type_map}.jsonl" localrule: True threads: 1 resources: @@ -57,11 +57,11 @@ rule prefilter_reads_extract: otherwise=rules.prefilter_reads_taxonomy.output.read_id, ), output: - fq="results/reads/prefilter/extract/{sample}_{library}_{read_type_map}.fastq.gz", + fq="//prefilter/extract/{sample}_{library}_{read_type_map}.fastq.gz", log: - "logs/reads/prefilter/extract/{sample}_{library}_{read_type_map}.log", + "//prefilter/extract/{sample}_{library}_{read_type_map}.log", benchmark: - "benchmarks/reads/prefilter/extract/{sample}_{library}_{read_type_map}.jsonl" + "//prefilter/extract/{sample}_{library}_{read_type_map}.jsonl" params: command="grep", extra="--invert-match --delete-matched", @@ -73,16 +73,22 @@ rule prefilter_reads_extract: "v7.9.1/bio/seqkit" -use rule shard_bowtie2 from workflow_taxon_prefilter as taxon_prefilter_shard_bowtie2 with: - input: - sample=workflow_taxon.get_data, - idx=workflow_taxon_prefilter.get_index, +def get_data_prefilter(wildcards): + return [rules.prefilter_reads_extract.output.fq] + + +workflow_taxon.get_data = get_data_prefilter use rule shard_bowtie2 from workflow_taxon as taxon_shard_bowtie2 with: input: - sample=[rules.prefilter_reads_extract.output.fq], - idx=workflow_taxon.get_index, + sample=get_data_prefilter, + idx=workflow_taxon.get_bowtie2_index, + + +use rule shard_dragen_csv from workflow_taxon as taxon_shard_dragen_csv with: + input: + sample=get_data_prefilter, ########## @@ -94,12 +100,12 @@ rule prefilter_fastqc: input: rules.prefilter_reads_extract.output.fq, output: - html="stats/reads/fastqc/prefilter/{sample}_{library}_{read_type_map}.html", - zip="stats/reads/fastqc/prefilter/{sample}_{library}_{read_type_map}_fastqc.zip", + html="//fastqc/prefilter/{sample}_{library}_{read_type_map}.html", + zip="//fastqc/prefilter/{sample}_{library}_{read_type_map}_fastqc.zip", log: - "logs/reads/fastqc/prefilter/{sample}_{library}_{read_type_map}.log", + "//fastqc/prefilter/{sample}_{library}_{read_type_map}.log", benchmark: - "benchmarks/reads/fastqc/prefilter/{sample}_{library}_{read_type_map}.jsonl" + "//fastqc/prefilter/{sample}_{library}_{read_type_map}.jsonl" threads: 4 resources: mem=lambda w, attempt: f"{3* attempt} GiB",